Здравствуйте, Гость! Чтобы получить доступ ко всем функциям форума - войдите или зарегистрируйтесь.

Автор Тема: Missing 411  (Прочитано 7297 раз)

0 пользователей и 1 Гость просматривают эту тему.

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« : 13.01.20 16:16 »
Предлагаю информацию по проекту David Paulides - Missing 411 обсуждать в этой теме.
На форуме накопилось много упоминаний проекта, предлагаю попробовать информацию об этом человеке, его деятельности, итогах и выводах аккамулировать здесь.

Добавлено позже:
Предлагаю разообрать это видео по пунктам

https://www.youtube.com/watch?v=B7cqx6CK0I0&feature=youtu.be#
« Последнее редактирование: 13.01.20 16:51 »
Камень, который отвергли строители, сделался главою угла.


Поблагодарили за сообщение: Солдат Василий

За отзывчивость и общественный авторитет 

Gulia70


  • Сообщений: 13 863
  • Благодарностей: 18 819

  • Расположение: Москва

  • Была 18.07.20 23:44

Missing 411
« Ответ #1 : 13.01.20 17:47 »
предлагаю здесь не зацикливаться только на СЧ. :)

Предлагаю разообрать это видео по пунктам
там 5 видео по этой теме.

сказано, что
-исчезновения людей происходят в любой точке мира.
-главным образом -на природе (лес, поле, горы)
-чаще всего люди пропадают незаметно. бывает так - шли группой, вроде все рядом, повернулись... одного уже нет.
-могут пропадать люди любого возраста и статуса. даже есть случаи, что пропадали охотники , которые знают этот лес и способы выживания .(есть такое видео, третье из цикла вроде)
-через какое-то время могут найти одежду (иногда сложенную стопочкой)
-при этом часто меняется погода на следующий день, что затрудняет поиски
-если человека находят, он может рассказывать странные вещи (типа глюков)
-иногда на поисках присутствует ФБР, которая обычно не выезжает на поиски (может проверяют версию с НЛО, СЧ и т.п.?)


Поблагодарили за сообщение: Sergei_VL | Солдат Василий

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #2 : 13.01.20 18:06 »
1-место
люди пропадают в ненаселенной местности, при том там есть водоемы
2-состояние
разные люди в разном состоянии (здоровые и больные, дети, молодые и старые)
3-собаки
быстро теряют или не находят след, не могут отследить запах
4-разделение
человек отошел от группы и пропал, часто безшумно или показалось что вскрикнул
5-погода
резкое, иногда аномальное изменение после случая с пропажей
6-одежда, обувь
обувь выкинута отдельно, одежда вывернута наизнанку или сложена и находится в труднодоступных местах, куда пропавший не мог бы ее отнести
7-заболевание
состояние схожее с гриппом, амнезия
8-ягоды
пропавший собирал грибы или ягоды
9-сопровождающиеся сущности
рассказы выживших о странных сущностях (ребенка кормил медведь или человек видел якобы знакомого)

Добавлено позже:
предлагаю здесь не зацикливаться только на СЧ. :)
Отвергая - предлагай,  *YES*
Я как изучающий тему СЧ, могу если понадобится, предположить объяснение по каждому пункту. Естесственно, в виде гипотезы.
« Последнее редактирование: 13.01.20 18:09 »
Камень, который отвергли строители, сделался главою угла.


Поблагодарили за сообщение: Солдат Василий

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #3 : 13.01.20 19:23 »
Возьмём пункт 3 - собаки не берут след пропавшего
Вопрос: сможет ли собака следовать за незнакомым тошноиворным неприятным ей запахом, перебивающим и не имеющим отношения к запаху того, кого ей надо искать?
Разворачиваемый текст
Ответ: нет конечно, она натаскана, допустим, на запах пропавшего в этом сюжете мальчика, а она чувствует на каком-то этапе сильно неприятный ей, даже пугающий, совсем другой запах.
Далее, в каком то месте запах пропавшего есть, а дальше его нет. О чем это говорит?
О том, что данный человек в одном месте наступал ногой, а дальше - нет, плюс его перебил другой, плохой запах. Почему ребенок там не наступал? Очень просто - похититель взял его на руки и унес. Вспомним странный вопрос пропавшего мальчика о медведе. Может он видел нечто, напомнившее ему медведя? И образ медведя не один раз встречаетмя в рассказах найденых малышей. "кормил медведь", "на болото занес медведь и приносил пищу".
Но вернемся к запаху. А если добавить то, что ребенок сам не шел, и есть еще один фактор, очень часто сопровождающий исчезновения - наличие реки или водоема, чего ждать от собаки в таком случае?
« Последнее редактирование: 13.01.20 19:24 »
Камень, который отвергли строители, сделался главою угла.


Поблагодарили за сообщение: Солдат Василий

wertik


  • Сообщений: 100
  • Благодарностей: 27

  • Расположение: Москва

  • Был 27.07.20 22:09

Missing 411
« Ответ #4 : 26.01.20 02:33 »
Отвергая - предлагай,  *YES*
Я как изучающий тему СЧ, могу если понадобится, предположить объяснение по каждому пункту. Естесственно, в виде гипотезы.
Всегда мне интересно почитать на эту тему.
Цитирование
1-место
люди пропадают в ненаселенной местности, при том там есть водоемы
Вот это прям как закономерность, а потом их находят в том водоеме..

За активное участие в жизни форума 

superskeptik


  • Сообщений: 4 971
  • Благодарностей: 3 467

  • Заходил на днях

Missing 411
« Ответ #5 : 26.01.20 03:46 »
там 5 видео по этой теме.сказано, что-исчезновения людей происходят в любой точке мира.-главным образом -на природе (лес, поле, горы)-чаще всего люди пропадают незаметно. бывает так - шли группой, вроде все рядом, повернулись... одного уже нет.-могут пропадать люди любого возраста и статуса. даже есть случаи, что пропадали охотники , которые знают этот лес и способы выживания .(есть такое видео, третье из цикла вроде)-через какое-то время могут найти одежду (иногда сложенную стопочкой)-при этом часто меняется погода на следующий день, что затрудняет поиски-если человека находят, он может рассказывать странные вещи (типа глюков)-иногда на поисках присутствует ФБР, которая обычно не выезжает на поиски (может проверяют версию с НЛО, СЧ и т.п.?)
И?
По каждому пункту можно предложить тривиальное объяснение (и даже не одно). Ничего необычного из этого не следует.
Увы и ах.

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #6 : 30.01.20 14:53 »
Под одним из роликов есть комментарий, в котором автор рассказывает о случае, произошедшем в квартире: вышла на балкон, чтобы переждать рекламную паузу, любовалась видами, а когда вернулась - передача уже закончилась. Оказалась, провела на балконе намного больше времени, чем казалось. Если бы шла по лесу, прошла бы значительное расстояние, и не заметила бы этого. В результате, имела бы неверные представления о своём местонахождении... Т.е., заблудилась бы.

Отойти в чащу, "что-то увидев" - запросто! Я когда-то рассказывала о странных впечатлениях в парке... Одно из них - показалось, что сделали "игрушечного" идола, вроде тех, которые ставят на детских площадках, вдобавок - что он был ярко раскрашен, а за ним - забор из сетки и какие-то интересные конструкции. Подумала "вроде, не должно тут быть такого", и пошла посмотреть... Ничего там не было: "рябь в глазах" и всё те же иллюзии из-за мерцания света между тонкими частыми стволами поросли.

Добавлено позже:
-могут пропадать люди любого возраста и статуса. даже есть случаи, что пропадали охотники , которые знают этот лес и способы выживания .(есть такое видео, третье из цикла вроде)
Я там обратила внимание на высказывание свидетеля о том, что он слышал звук, похожий на звук сработавшей металлической ловушки... Может, кто-то что-то подобное там использовал? Самая близкая версия из "теорий заговора" - о том, что стариков ловят геронтологи для опытов при создании лекарства от старости :) Другие варианты там высказывались: дырки в земле, волчьи ямы...

В пользу похищения - то, что авторитетного старичка искали таким методом, что обязательно должны были найти: живым или мёртвым. Либо под землю провалился, либо, к моменту начала поисков, его уже куда-то умыкнули.
« Последнее редактирование: 30.01.20 15:25 »

За отзывчивость и общественный авторитет 

Gulia70


  • Сообщений: 13 863
  • Благодарностей: 18 819

  • Расположение: Москва

  • Была 18.07.20 23:44

Missing 411
« Ответ #7 : 30.01.20 16:07 »
И?
По каждому пункту можно предложить тривиальное объяснение
можно. а я сказала, что там по каждому пункту инопланетяне?
я своими словами пересказала выводы David Paulides из ролика

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #8 : 30.01.20 18:35 »
По теме интересны два док. фильма Missing 411:

1) Missing 411 (2017). Акцент на исчезновения детей в лесах.
2) Missing 411: The Hunted (2019). Акцент на исчезновения охотников и опытных туристов. На мой взгляд более интересный.
Смотреть можно в любом порядке.

Во втором фильме есть аудиозапись  звуков существ, перекрикивающихся с охотниками. Достаточно разнообразные звуки; перекрикивались в прямом смысле, охотники пытались имитировать крики. Что интересно, перед "концертом" слышались металлические звуки (наподобие камертона), что неожиданно перекликается с известным видео Серёги-охотника  :cl:


Поблагодарили за сообщение: Sergei_VL

arfaxad


  • Сообщений: 889
  • Благодарностей: 714

  • Расположение: Кубань

  • На форуме

Missing 411
« Ответ #9 : 30.01.20 20:02 »
David Paulides
Table 1. List of Purported Sasquatch DNA Specimens
(в т.ч. North America Bigfoot Search (Dave Paulides) From Ulibarri)
http://sasquatchgenomeproject.org/linked/tables-156.pdf
в этом документе приведена и нуклеотидная последовательность "СЧ":
CGCGCTGGTGGTGGCCACCAT
TGCTGGTGAGCGGGAGCAACG
CGGGAGCAACGTGCTGGAGAC
GACCCTGCCGCGGGCGCGGCG
ATCGCCTACTACGACCACGTG
ATCGCCTACTACGACCACGTG
TCTTCTTCCTGGCTATGCTGG
GCTATGCTGGTGCTCATGGCC
TGCCATCATCGACCCCCTCAT
GAGCTCCGCAGGACGCTCAA
тогда вот по этой последовательности вторичная белковая структура "СЧ":
https://funkyimg.com/i/31Q6X.jpg

дополнительно :
Novel North American Hominins, Next Generation Sequencing of Three Whole Genomes
and Associated Studies
http://www.sasquatchgenomeproject.org/linked/novel-north-american-hominins-final-pdf-download.pdf

DNA as evidence for the existence of relict hominoids
(ДНК как свидетельство существования реликтовых гоминоидов)
https://www.isu.edu/media/libraries/rhi/research-papers/HART-DNA-Evidence.pdf
Dr. Haskell V. Hart holds a PhD in chemistry from Harvard University and has a physical,
inorganic, and analytical chemistry research background. He was Associate Professor of
Chemistry, University of North Carolina at Wilmington, after which he was Senior Staff
Research Chemist and Research Manager at Shell Chemicals.
https://bigfootclaims.blogspot.com
« Последнее редактирование: 30.01.20 20:56 »
иногда счастье — это когда ничего не происходит

За отзывчивость и общественный авторитет 

Gulia70


  • Сообщений: 13 863
  • Благодарностей: 18 819

  • Расположение: Москва

  • Была 18.07.20 23:44

Missing 411
« Ответ #10 : 30.01.20 22:47 »
Акцент на исчезновения охотников
мне понравился эпизод с пожилым охотником. где его товарищ слышал звук захопывающейся ловушки.

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #11 : 31.01.20 00:26 »
мне понравился эпизод с пожилым охотником. где его товарищ слышал звук захопывающейся ловушки.
Если это первый случай (с 82-летним охотником), то товарищ сказал что-то вроде "короткий звук, который он не может описать, не похожий ни на один лесной звук".

Во втором фильме есть аудиозапись  звуков существ, перекрикивающихся с охотниками.
А вот добрые люди с reddit уже её извлекли из фильма и немного почистили:
https://old.vocaroo.com/i/s14IioKZWSD1

arfaxad


  • Сообщений: 889
  • Благодарностей: 714

  • Расположение: Кубань

  • На форуме

Missing 411
« Ответ #12 : 31.01.20 21:08 »
David Paulides
при исследовании биологических образцов были и сюрпризы, например два образца волос из Гималаев
совпали с ДНК, извлечённой у 40000-летнего ископаемого полярного медведя, и что странно, их ДНК
не совпадает с живущими сегодня полярными медведями.
учёным просто нужно найти больше ДНК этих загадочных животных, если другие участки ДНК также
совпадают с участками древних полярных медведей, тогда эту нулевую гипотезу можно будет отвергнуть.
так нулевая гипотеза поддерживает жизнь волосатого гоминида.
https://habr.com/ru/post/409063/
&
было бы прикольно если бы в биообразцах "СЧ" нашли бы 5-й и 6-й нуклеотид ДНК новую базовую пару.
в земных ДНК их всего 4 вида нуклеотидов.
https://www.yapfiles.ru/show/576379/87595601d4e698cf8d96fb6fdaa27d02.flv.html
&
пока мы имеем то что имеем, благодаря в том числе неутомимому детективу  Dave Paulides обнаружены
биологические образцы артефакты, в этих образцах найдена определённым образом структурированная
нуклеотидная последовательность, при всём при том что искалась по аналогии с земными ДНК:
http://sasquatchgenomeproject.org/linked/tables-156.pdf
по этой последовательности можно определить вторичную структуру белка принадлежащего "СЧ".
Sasquatch-n1.pdb :
http://forumfiles.ru/files/001a/87/44/46482.txt
вот визуализация 3D модель вторичной структуры этого найденного протеина.

в Jmol 14.30.1 2019 :
Jmol - Browse /Jmol/Version 14.30/Jmol 14.30.1 at SourceForge.net
https://sourceforge.net/projects/jmol/files/Jmol/Version%2014.30/Jmol%2014.30.1/
для любителей поизучать, для этого не надо быть молекулярным биологом.
иногда счастье — это когда ничего не происходит


Поблагодарили за сообщение: Sergei_VL

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #13 : 01.02.20 12:41 »
arfaxad, а откуда у всех такая вера в непогрешимость исследований ДНК? И еще больше смущает этот радиоуглеродный анализ, который всегда дает результат исследования любых костей десятки тысяч лет, и никогда не выдает 200 лет, 300 лет, 750 лет, тысячу лет?  Нашли на Новосибирских островах тушу мамонта, все волосы целы, разморозили - кровь льется. Заключение: "туша пролежала 40 000 лет". Ну и что лед? Кости животного за 10 лет так истлевают, а тут несоизмеримые величины!
Есть ощущение, что брехня с доисторическими видами, жившими якобы ТАК давно многим попросту выгодна. ...Всё не наше, необычное могло быть только в глубокой древности, а там кто знает - всё могло быть, никто теперь за это не ручается.
« Последнее редактирование: 01.02.20 12:42 »
Камень, который отвергли строители, сделался главою угла.


Поблагодарили за сообщение: arfaxad

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #14 : 01.02.20 14:53 »
Sergei_VL, позвольте вставить 5 копеек.

"Вера" в ДНК заключается в том, что этот метод широко используется в повседневной жизни (напр. в криминалистике и судебной практике это разница между свободой и электрическим стулом). И при наличии образцов, исследование воспроизводимо любым другим исследователем в любой другой точке мира (так, напр. в исследовании Сайкса контрольные образцы есть и в Швейцарии).

Если криптозоолог не желает пользоваться научными инструментами, он может "публиковаться" на форумах, им самим созданным журналах, сайтах и проч., и "здравомыслящей рациональной части человечества" его откровения не интересны, т.к. он попадает в разряд НЛО, заряженной воды, хиромантии, лечения уриной и проч.

Если исследователь пользуется научными инструментами, но пытается подогнать результаты под свои убеждения, то опять же его данные не пройдут peer review научного журнала, и остается публиковаться самому (грубо говоря, в стенгазете). См. пример Кетчам.

Если исследователь работает в русле научного метода, он и публикуется нормально, может ошибаться, признавать ошибки и искать истину дальше. См. пример Сайкса. Тут, понятно, если исследователь ученым не является, образования не имеет, то обратить на себя внимание ему сложнее и через фильтр скептицизма пройти. Но это возможно, если его публикации или данные валидны и должным образом оформлены.

Однако нельзя не отметить, что "научное сообщество" вовсе не рыцари, они ошибаются и испытывают эмоции, напр. страх. Так, какой-нибудь член редколлегии просто откажется рассматривать исследования о сасквочах, из-за страха прослыть мракобесом и повредить репутации журнала. Или проявит тупой догматизм (см. скандал по поводу глобального потепления).

Вкратце: есть выбор между имиджем добросовестного исследователя и фрика-паранормальщика. От имиджа зависит то, как будут восприняты результаты исследований. Кстати, прекрасное на мой взгляд качества Дэвида Полидеса это то, что он сейчас только нарабатывает данные в своих книгах и фильмах, пытается привлечь внимание общественности, а не выпускает на первый план сасквотчей без каких-либо обоснований.

По радиоуглеродному исследованию: см. контаминацию углеродом после промышленной революции, Туринская плащаница, мамонты на о. Врангеля.


Поблагодарили за сообщение: arfaxad

arfaxad


  • Сообщений: 889
  • Благодарностей: 714

  • Расположение: Кубань

  • На форуме

Missing 411
« Ответ #15 : 01.02.20 20:18 »
откуда у всех такая вера в непогрешимость исследований ДНК
пока насколько можно судить по литературе идёт сравнение неизвестного с известным.
это тот метод который в данном случае можно применить с научной точки зрения,
если находят различные биоматериалы (шерсть, когти, продукты жизнедеятельности и пр.)
то исследователи их прогоняют через тесты ДНК на принадлежность к тем или иным
известным животным, при этом остаются результаты исследований которые качественно
нельзя с полной уверенностью отнести к определённым отрядам и группам, видам.

так как сравнение надо делать чтобы совпали эти короткие найденные цепочки AGCT с огромным
количеством уже имеющихся известных образцов в генбанках, с учётом того что эту работу
делают не на государственном уровне, а на уровне энтузиастов криптозоологов, которые
самостоятельно изучают форматы файлов FASTA и PDB (био), NCBI онлайновые протеиновые
сервисы, прикладные программы по молекулярной биологии, и др.
ещё один момент почему повсюду у учёных находятся чёрные вымершие медведи и нет "СЧ",
они же не могут пожертвовать ради своих исследований профессиональной карьерой и
репутацией академических учёных, ведь про медведей они могут писать всю жизнь и получать
зарплату, а про "СЧ" только один раз, после чего отправятся на биржу труда как фрики от науки.
и алгоритм определения инопланетных ДНК отсутствует именно по причине неизвестных пока
признаков таких ДНК, станут известны перестанут кивать на мутации, скажут вторжение.
это же справедливо не только в отношении вирусов известных пандемий, но и онковирусов.
иногда счастье — это когда ничего не происходит

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #16 : 02.02.20 16:15 »
https://newsfeed.time.com/2012/11/29/bigfoot-is-part-human-according-to-dubious-sounding-bigfoot-dna-tests/
Вот про ДНК: "близко к человеку"
Важно воспринимать как именно дикого человека, а не животное - это ключ.
Но лучше по СЧ в отдельно существующей теме.
Камень, который отвергли строители, сделался главою угла.

AtlanticPacific


  • Сообщений: 113
  • Благодарностей: 146

  • Расположение: Москва

  • Был 07.08.20 17:38

Missing 411
« Ответ #17 : 02.02.20 22:32 »
По теме интересны два док. фильма Missing 411:

1) Missing 411 (2017). Акцент на исчезновения детей в лесах.
2) Missing 411: The Hunted (2019). Акцент на исчезновения охотников и опытных туристов. На мой взгляд более интересный.
Смотреть можно в любом порядке.

Во втором фильме есть аудиозапись  звуков существ, перекрикивающихся с охотниками. Достаточно разнообразные звуки; перекрикивались в прямом смысле, охотники пытались имитировать крики. Что интересно, перед "концертом" слышались металлические звуки (наподобие камертона), что неожиданно перекликается с известным видео Серёги-охотника  :cl:
А что это за известное видео? Мне Гугл миллион вариантов просто предложил

По теме: меня у автора немного смущает тенденция к каталогизации, что ли: помните, он делил пропавших чуть ли не по принадлежности к языковой группе. Понятно, что за этим стоит желание найти ответ, но выглядит немного странно.
« Последнее редактирование: 02.02.20 22:37 »

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #18 : 02.02.20 22:49 »
По теме: меня у автора немного смущает тенденция к каталогизации, что ли: помните, он делил пропавших чуть ли не по принадлежности к языковой группе. Понятно, что за этим стоит желание найти ответ, но выглядит немного странно.
Он обязан установить закономерности тех, кто пропадал, чтобы выйти на причину. Это - единственный способ - фиксировать все случаи и сводить в таблицу. С таблицами как раз интересные дела получаются: начинают вырисовываться одни и те же детали пропаж.
Например. Пропадает человек всегда в одиночку. Подставим некий нелепый пример, чтобы получить "доказательство от противного". К примеру, открывается некий портал, который поглащает несчастного. Или: человек в определенной геомагнитной точке начинает терять ориентировку. Ок. Допустим так. Но поисковики не теряют там ориентировку, а хитрый портал забирает человека одного, когда никто не видит, а не двух, не группу, не десять. Ничего не смущает? А нет ли ощущение, что нечто имеет избирательный характер, оно как бы выслеживает одинокого путника? А как выслеживать может неодушевленное?
И сразу туман, который нагоняется в сетях, рассеивается, а куча нелепых версий отпадают.
Камень, который отвергли строители, сделался главою угла.


Поблагодарили за сообщение: auspex

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #19 : 02.02.20 23:59 »
AtlanticPacific,
Серега-охотник ч.2
https://www.youtube.com/watch?v=dWdpDGJbXZk#


По теме: меня у автора немного смущает тенденция к каталогизации, что ли: помните, он делил пропавших чуть ли не по принадлежности к языковой группе. Понятно, что за этим стоит желание найти ответ, но выглядит немного странно.
Как правильно написал выше Sergei_VL, "Это - единственный способ - фиксировать все случаи и сводить в таблицу". Но Дэвид замечен в применении confirmation bias (подгонку результатов под канву исследования). Напр. недооценивает смертельность гипотермии (как раз по тематике форума), иногда опускает такие детали, как наркотическое опьянение жертвы и проч. Надо же как-то книги продавать, тут всё понятно  :-[

Главное, что методика его верная, как мне кажется: собирать, каталогизировать, наносить на карту, сопоставлять. А как к гуру относиться и секту образовывать вокруг него, ну нафиг.

А как выслеживать может неодушевленное?
Да очень просто, по набору качеств. Ваш никнейм начинается на S, имеет 9 символов, тон аватарки тёмный, пишете по-русски -- неодушевленная софтина вас выберет на форуме среди десятка других представленных на некой странице.

В нете есть софтбольные автоматические турели на Ардуино с распознаванием движения и фигуры человека. Можно прикрутить тепловизор, добавить кода -- et voila, турель будет стрелять первым в самого теплого, ну или холодного. И так далее.
« Последнее редактирование: 03.02.20 00:00 »

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #20 : 03.02.20 03:39 »
Да очень просто, по набору качеств. Ваш никнейм начинается на S, имеет 9 символов, тон аватарки тёмный, пишете по-русски -- неодушевленная софтина вас выберет на форуме среди десятка других представленных на некой странице.
Так, выбрала. С какой целью? Некто сидит в форуме. А некто поехал на природу и пропал. Какая связь?
Цитирование
В нете есть софтбольные автоматические турели на Ардуино с распознаванием движения и фигуры человека. Можно прикрутить тепловизор, добавить кода -- et voila, турель будет стрелять первым в самого теплого, ну или холодного. И так далее.
Автовыбор программы. А кто тепловизор прикручивает, робот, который должен следить за случайным объектом?
Чего-то вы "не в ту степь".
Камень, который отвергли строители, сделался главою угла.

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #21 : 03.02.20 09:30 »
Какая связь?
Не воспринимайте буквально. Я имел в виду, что для избирательности "виновнику" не нужен интеллект.

Чего-то вы "не в ту степь".
У меня нет "степи" пока, но порталы и тайные подземные базы похитителей всерьез не рассматриваю.
Хотя любители порталов приободрились:
https://www.nasa.gov/mission_pages/sunearth/news/mag-portals.html

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #22 : 03.02.20 09:39 »
Не воспринимайте буквально. Я имел в виду, что для избирательности "виновнику" не нужен интеллект.
Для меня не понятно. Приборы по похищению людей кто то изобрел, и они настроены строго на одного?
Камень, который отвергли строители, сделался главою угла.

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #23 : 03.02.20 09:56 »
Для меня не понятно. Приборы по похищению людей кто то изобрел, и они настроены строго на одного?
Приборы были для примера. Можете взять существо с простым таксисом, если хотите что-то биологическое, но не способное к мышлению.

Я думаю, не существуют вообще никаких надежных рациональных способов узнать на расстоянии (и быстро), какая из потенциальных жертв имеет хорошее образование или германские корни. А если тепло одетая жертва повернута спиной или носит лыжную маску, то и возраст просто так не определишь.

Возраст, раса, герм. корни и образование это маркеры-критерии Дэвида, не мои.

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #24 : 03.02.20 10:36 »
Приборы были для примера. Можете взять существо с простым таксисом, если хотите что-то биологическое, но не способное к мышлению.

Я думаю, не существуют вообще никаких надежных рациональных способов узнать на расстоянии (и быстро), какая из потенциальных жертв имеет хорошее образование или германские корни. А если тепло одетая жертва повернута спиной или носит лыжную маску, то и возраст просто так не определишь.

Возраст, раса, герм. корни и образование это маркеры-критерии Дэвида, не мои.
Идут по каньону Колорадо 10 человек. Один из них мальчишка со своим рюкзачком. Группа растянулась, одни шли спереди, другие - позади. Он где то между теми и теми. Сбился немного, прошел по какой-то другой тропке. Через 7 минут его стали звать, через 20 искать. Пару месяцев сотни человек с техникой и собаками не могут ничего обнаружить, прочесывая ельники и скалы по десяткам раз - никаких следов, находят только его одежду и обувь.
Тот же самый риторический вопрос - ни один интеллект, искусственный или натуральный, не может просчитать вероятности что:
- группа будет состоять из стольких-то человек, это не задумка, а импровизация
- группа выйдет в определенное время и на точке пропажи ребенок тоже окажется в определенное время
- ребенок оторвется от группы
- место, куда надо уходить, забрав его, не будет посещаемым и ребенка не заметят
Все параметры случайны. 1987 год. Какие таксисты с системами слежения и софтина, осуществляющая отбор жертвы по аватару???)))
Камень, который отвергли строители, сделался главою угла.

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #25 : 03.02.20 11:01 »
Какие таксисты с системами слежения и софтина, осуществляющая отбор жертвы по аватару???)))
Понял, аналогии вам "больше не наливать". Значение слова "таксис" посмотрите в Вики сами, если пожелаете.

Далее, по представленному вами случаю, версии могут быть а) нормальные (а1 под оползнем, а2 криминал, а3 звери...) и б) паранормальные (б1 порталы б2 бигфут б3 заговор правительства...). Никаких версий я не выбирал, а просто указал вам, что в категории Б могут быть варианты без участия разума и плана. Например, гипотетический портал способен переносить людей массой до 40 кг, и только при скорости солнечного ветра > 800 км/с, и только в радиусе 20 метров. Поэтому ни другие участники похода, ни дети в другие дни, ни поисковики в него не попали. Понимаете?

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #26 : 03.02.20 13:20 »
Далее, по представленному вами случаю, версии могут быть а) нормальные (а1 под оползнем, а2 криминал, а3 звери...) и б) паранормальные (б1 порталы б2 бигфут б3 заговор правительства...).
Начнем с Дэвида. Сам он не мог не склоняться к какой-то одной, дежурной версии. Теперь информация о его размышлениях перемешана черти с чем и мы истину о его мнении никогда не узнаем. Но я предлагаю придержитваться формулы Дэвида: одна из причин - общая для всех случаев, она неизвестна, вторая - естесственные версии, перемешавшиеся с основными, автор не смог их однозначно отбросить как не пригодные к проекту 411.
a1 - вероятность оползней автор должен был рассматривать и все случаи имеющие "природный катаклизм, вряд ли бы попали в проект 411.
а2 - предполагает одушевленное существо или существ, смущает только огромное количество жертв, у серийника с типичным в конкретной ситуации поведения не может быть такого количества аналогичных случаев, но в частности - очень вероятно,
а3 - вероятно, но часто имеет место странное поведение жертвы,
б1 - один отбившийся человек не может постоянно быть жертвой порталов, портал - неодушевленное; с другой стороны - портал очень сложное для понимания и неопределенное, надо искать более простые решения
б2 - очень вероятно, и Дэвид одно время проводил параллели со следами и свидетелями bf в районе пропаж,
б3 - исключается: правительство - люди на доожности, им невозможно подбирать агентов, чтобы они воровали маленьких детей, здесь одни противоречия;
но заговор правительства может иметь место в варианте с bf. Возможно, этих существ не хотят озвучивать по некоторым причинам, например, те же неисследованные опасные вирусы.
Цитирование
Никаких версий я не выбирал, а просто указал вам, что в категории Б могут быть варианты без участия разума и плана. Например, гипотетический портал способен переносить людей массой до 40 кг, и только при скорости солнечного ветра > 800 км/с, и только в радиусе 20 метров. Поэтому ни другие участники похода, ни дети в другие дни, ни поисковики в него не попали. Понимаете?
Я не зря вам указывал на разумный след - живых существ. Избирательность на пути следования человека. Никто никогда на глазах у свидетелей не растворялся, но человек вдруг поднялся на гору сфоткать, где его было не видно, или зашел в лесок или потерялся.
Камень, который отвергли строители, сделался главою угла.

За активное участие в жизни форума 

superskeptik


  • Сообщений: 4 971
  • Благодарностей: 3 467

  • Заходил на днях

Missing 411
« Ответ #27 : 04.02.20 00:52 »
можно. а я сказала, что там по каждому пункту инопланетяне?
я своими словами пересказала выводы David Paulides из ролика
Так выводы (его, а не ваши (я к Вам без претензий)) пустые.
"Экстраординарные заявления требуют экстраординарных доказательств".
А тут заявление примерно следующего содержания: "все люди смертны". Так все это и так знают.

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #28 : 04.02.20 07:35 »
А тут заявление примерно следующего содержания: "все люди смертны". Так все это и так знают.
В качестве ответа родственникам пропавших интересный вариант, из серии все там будем.
Дэвид не обобщал случаи, а классифицировал, это разные вещи. Он составлял таблицу с целью определить закономерности. А главное отсеить шапкозакидательные заявления не желавших вникать в непонятные дела.
Обобщать конечно можно, но это и есть - непрофессиональное отношение в расследовании.
« Последнее редактирование: 04.02.20 07:36 »
Камень, который отвергли строители, сделался главою угла.

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #29 : 04.02.20 19:24 »
Никто никогда на глазах у свидетелей не растворялся, но человек вдруг поднялся на гору сфоткать, где его было не видно, или зашел в лесок или потерялся.
Вот это и наводит на мысль о том, что причина - в странных действиях самих пропавших людей. Причина, по которой человек уходит в какой-то лесок, часто непонятна: объяснимой причины нет. Например, девушка хотела фотографировать озеро, а сама, пройдя по берегу, зачем-то зашла в лес. Другая шла по тропе, но вдруг будто что-то увидела, и свернула в лес. При этом, место было очень неудобным для сворачивания в ту сторону. За 300 метров по некрутой тропе до вершины, на которую шла группа, мальчик жалуется на сильную усталость и выражает желание подождать группу на этом месте, а потом встаёт и зачем-то куда-то уходит - не за группой, и даже не по какой-то тропе, а по каменистому склону. Вот так он "сильно устал"... И всё это - в местности с редкими деревьями, где всё хорошо просматривается.

Про раздевания: отмечает ли автор книги температуры, при которых произошло раздевание? Думаю, что случай с девушками в панамских джунглях - пример такого же раздевания, но в тёплых условиях. Объяснения в стиле "промокла, и повесила одежду сушиться" и "сняла обувь потому, что нога болела" не кажутся убедительными: эти вещи почему-то были оставлены, а не взяты с собой.
« Последнее редактирование: 04.02.20 19:32 »

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #30 : 06.02.20 01:27 »
Начнем с Дэвида. Сам он не мог не склоняться к какой-то одной, дежурной версии. Теперь информация о его размышлениях перемешана черти с чем и мы истину о его мнении никогда не узнаем. Но я предлагаю придержитваться формулы Дэвида: одна из причин - общая для всех случаев, она неизвестна, вторая - естесственные версии, перемешавшиеся с основными, автор не смог их однозначно отбросить как не пригодные к проекту 411.
Посмотрел фильм Дэвида Vanished (2019), похоже он таки на чём-то остановился в прошлом году. В своих интервью радио Coast to Coast он обычно ничего не говорил о своих версиях исчезновения людей, только по-моему упомянул, что версия вмешательства правительства и действия серийного убийцы им исключены.

В общем, зря я выше смеялся над порталами. Дэвид предполагает как раз версию порталов, аномалий в пространстве-времени, возникающих в местах залегания кварца, который и открывает портал вследствие эффекта Казимира. Ну или как-то так  %-)

И с этой идеей Дэвид уже посещает семьи пропавших, чтобы сообщить им предполагаемую "судьбу" их близких. Ноу комментс, как говорится.
Кстати, Дэвид зачем-то спросил физика, может ли правительство контролировать эти порталы, на что получил положительный ответ. Это намек на синтетическую версию порталы+правительство? С другой стороны, в самом конце он сказал, что продолжит рассматривать все версии.

Кстати, в фильме даже история ГД упоминается, вкратце и с искажениями. Так, тела были найдены, якобы, в 9 милях от палатки (>14 км!). Даже погуглить поленились.

По поводу отдельных версий, мне кажется, спорить о них можно только на основе конкретных случаев. Дэвид в фильме сказал, что пропавших, соответствующих его критериям у него уже более 1600 (на момент съемки фильма). Интересно было бы, конечно, начать составлять собственные подобные списки, но, к сожалению, в постсоветских странах нет такой полезной вещи как Freedom of Information Act, т.е. власти исследователей просто пошлют нафиг. Останется только из интернета всякие сплетни собирать.

Я не зря вам указывал на разумный след - живых существ. Избирательность на пути следования человека. Никто никогда на глазах у свидетелей не растворялся, но человек вдруг поднялся на гору сфоткать, где его было не видно, или зашел в лесок или потерялся.
Скажем так, в растворение в воздухе никто бы не поверил,  а человек с упорством доказывающий эту версию, стал бы первым подозреваемым в убийстве.

P.S. Ссылка на подборку интервью Дэвида CtC AM:
https://www.youtube.com/playlist?list=PLrkQ-NM-_yCYFrEoIZNOdEtg5D1-Fe3As

mrv


  • Сообщений: 8 379
  • Благодарностей: 8 572

  • Расположение: США

  • Была сегодня в 11:44

Missing 411
« Ответ #31 : 06.02.20 05:57 »
Господи, ещё и порталы.  *JOKINGLY* Вот не нашли бы мальчика в болоте в соседней ветке, тоже наверно на порталы подумали бы.  *JOKINGLY*


Поблагодарили за сообщение: superskeptik

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #32 : 06.02.20 09:07 »
Господи, ещё и порталы.  *JOKINGLY* Вот не нашли бы мальчика в болоте в соседней ветке, тоже наверно на порталы подумали бы.  *JOKINGLY*
Да... порталы во всех расследованиях как сорняки на грядках.
Камень, который отвергли строители, сделался главою угла.

AtlanticPacific


  • Сообщений: 113
  • Благодарностей: 146

  • Расположение: Москва

  • Был 07.08.20 17:38

Missing 411
« Ответ #33 : 13.02.20 23:42 »
AtlanticPacific,
Серега-охотник ч.2
https://www.youtube.com/watch?v=dWdpDGJbXZk#
Спасибо за видео.
Оффтоп (текст не по теме)
что бы я когда-нибудь пошла ночью одна в лес ...

Что касается порталов - ну, весьма в духе популярных историй про лестницы в лесу :) понятно, что явление «врет, как очевидец»  изучено вдоль и поперёк, но меня до сих пор не перестаёт удивлять то, что люди, прочитав заведомый фейк (как в случаях с лестницами), совершенно искренне вспоминают нечто подобное- и они-то, в отличие от тс - не лукавят.

Оффтоп (текст не по теме)
Когда-то на три же Reddit читала размышления на тему порталов,  которые открываются «в другую сторону». Это было в теме John&jane does и автор таким образом отвечал себе на вопрос: ну как может быть, что их никто не ищет? Я помню, что заголовок треда был весьма броским: что типа (в очень вольном переводе): на 109 пропавших - 115 найденных
« Последнее редактирование: 14.02.20 01:42 »

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #34 : 22.02.20 11:33 »
популярных историй про лестницы в лесу
Ну лестницы в лесу были из крипи-саба, туда специально ходят читать страшные истории. С другой стороны, в таких тредах иногда и серьезно спрашивают ТС о подробностях, что чувствовал, а он серьезно как бы отвечает  *JOKINGLY*

В сабреддите Missing411 тоже куча историй подобного рода появляется, от телепортаций до просто "меня кто-то звал по имени с болота".

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #35 : 23.02.20 02:32 »
"меня кто-то звал по имени с болота"
Нормальные глюки. Остаётся только причину понять...

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #36 : 23.02.20 08:37 »
В Бурятии считается, что ребенка нельзя звать по имени, особенно в лесу, дикой местности и после захода солнца. Объясняется это тем, что злые духи могут услышать имя и в другой раз позвать человека по имени, сглазить, заманить и даже убить. Часто детям давали второе имя, неблагозвучное.
Разворачиваемый текст
«Нэрэ нэрлэхэ» раньше имело у бурят особенный смысл. В старину у многих семей дети умирали в раннем возрасте, из девяти-десяти малышей могли дорасти до совершеннолетия двое-трое. Поэтому многие буряты присваивали своим детям одно имя при рождении, другое записывали в метрику.

Отводное имя, как правило, должно было защитить мальчика. Поскольку к рождению мальчика буряты относились с особым почтением, его следовало защитить от злого одноглазого духа «ада», который душил детей. Поэтому были нередки случаи, когда мальчиков называли женским именем, либо просто называли «женщина» («hамган»). С тех пор пошла, допустим, фамилия «Хамаганов».

Придумывалось какое-нибудь неблагозвучное прозвище, чтобы злые духи не обратили внимание на ребенка. К примеру, часто ребенка звали Забаан (безвкусный, в переносном смысле — негодник), Хазагай (кривой), Хабтагар (плоский, широкий), Хара (черный). 
Были имена и вовсе отрицательные: Муу эзы (плохая, дурная жена), Эмэ (баба), Тэнэг (глупый), Архинша (пьяница) и т.д. Как считали наши предки, часто злых духов «вводили в заблуждение» имена, означающее животных: Тэхэ (козел), Буха (бык), Шоно (волк), Эмэ нохой (сука), Баха (лягушка) и даже Бааhан (какашка).«Отпугивающую» роль выполняли и такие имена, как Тyмэр (железо), Балта (молот), Шулуун (камень).


Камень, который отвергли строители, сделался главою угла.

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #37 : 01.03.20 04:11 »
Свеженький ролик... В июле 2018 года группа японских студентов решила посетить небольшой лес возле Нагои, и углубились в него на 500 метров. При возвращении, один из них сказал, что хочет пройти по более длинной тропинке, чтобы чуть дольше полюбоваться природой, и сказал на прощание: "увидимся в следующей жизни". И пропал... В 5 метрах от дорожки нашли телефон с набранным и не отправленным сообщением "помогите, я тут застрял". В 100 метрах от дорожки нашли его кроссовок, в котором лежало его ожерелье. Несмотря на небольшой размер леса (примерно, 2х2 км) и то, что лес был редким, его так и не нашли.

Загадочное исчезновение Такуми Фунисака

https://www.youtube.com/watch?v=HlHcz_GBjSE#


Поблагодарили за сообщение: Sergei_VL | SharpSolaris

Гарпия


  • Сообщений: 43
  • Благодарностей: 39

  • Была 25.04.20 09:30

Missing 411
« Ответ #38 : 15.04.20 11:36 »
А на русском есть переводы этих Миссингов?
Я всегда говорю правду. Даже когда вру.

За участие в жизни форума 

Никанор Босой


  • Сообщений: 5 157
  • Благодарностей: 5 248

  • Расположение: БАМ

  • Был вчера в 14:18

Missing 411
« Ответ #39 : 15.04.20 12:21 »
А на русском есть переводы этих Миссингов?
Нету. Так что гугл-транслит вам в помощь.

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #40 : 17.05.20 08:06 »
В джунглях Малайзии пропадают люди... Основная история - о девочке с врождённым нарушением развития головного мозга, проявляющегося, в числе прочего, нарушением координации - таким, что она не могла самостоятельно спуститься по крутой лестнице. Девочка пропала из гостиничного номера, и, спустя время, была найдена мёртвой в джунглях, в труднодоступном месте: как водится, девочка лежала на камнях в реке, и, несмотря на смерть в результате "разрыва кишечника", выглядела мирно спящей. На теле не было найдено синяков и других следов падений: лишь несколько небольших царапин на ногах. Это значит, что девочка не падала, и это заставляет сильно сомневаться в том, что она пришла туда сама. Кроме того, место, на котором она была найдена, до этого проверялось поисковиками.

Многие говорят: "раз она - псих, то сама шла. У неё - лунатизм". Но это - совсем другое: такие нарушения не проявляются время от времени, не зависят от ситуаций и не отступают.

Однажды там пропала целая группа спортсменов. В другой раз, все искали мальчика, которой вдруг обнаружился рядом с лагерем спящим, и его трудно было привести в чувства. Мальчик сказал, что пока его искали, он находился тут, и всё слышал, только не мог двигаться, а его никто не видел.

Местные шаманы рассказывают о лесных духах-свистунах, которые заманивают и уводят людей. Думаю, всё это делают сами шаманы ради поддержания своего авторитета и доходного ремесла (явно, к мальчику применили какой-то местный наркотик, а девочку как-то выманили и утащили, а нашли - после того, как шаман поколдовал и попросил духов её вернуть), но кто-то может подумать и о всякой нечисти.
Разворачиваемый текст
« Последнее редактирование: 17.05.20 08:16 »

mrv


  • Сообщений: 8 379
  • Благодарностей: 8 572

  • Расположение: США

  • Была сегодня в 11:44

Missing 411
« Ответ #41 : 17.05.20 09:15 »
Про эту девочку уже обсуждали в теме про преступления - могла она уйти, она только немного больная на голову была, а так с виду вполне здоровая.

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #42 : 17.05.20 11:37 »
mrv, если она даже по крутой лестнице спустится не могла - вряд ли. И эта проблема - не психогенная, а органическая... Там и склоны, и эти валуны, по которым прыгать надо, а у неё даже признаков падений нет... Скорее всего, подманили к окну и утащили. Тем более, там и с парнем такая странность была, и со спортсменами... Явно, к ним применили какой-то наркотик. Главный аргумент сторонников "сама ушла" - то, что её не изнасиловали, но если это - шаманы, то им сама чертовщина нужна: чем больше чертовщины, тем больше их авторитет и заработок.

Пропала одежда - нижнее бельё, в котором она спала:
Цитирование
Сообщается, что Нора Квойрин была найдена "раздетой" в холмистой местности с оврагом. Понятно, что она была босиком и носила только нижнее белье, когда исчезла, так как это была последняя одежда, которую видели ее родители. Непонятно, что случилось с ее одеждой.
https://theaseanpost.com/article/mysterious-death-nora-quoirin
Цитирование
Заместитель начальника полиции Мазлан Мансор сказал журналистам на пресс-конференции во вторник, что тело "не было в какой-либо одежде"
https://www.bbc.com/news/uk-england-london-49347944
В другой статье более чётко сказано, что она была голой.

Цитирование
Большое количество людей, вовлеченных в операции САР, включая местных следопытов, знакомых со сложной местностью джунглей, не смогли найти ее. Во вторник группа из 24 добровольцев, состоящая из опытных туристов, обнаружила тело молодой норы. Доброволец среди них сказал, что он считает, что она не могла быть в этом месте долго, потому что предыдущие поиски в том же районе нашли бы ее. Однако вскрытие показало, что она умерла по меньшей мере за четыре дня до того, как ее тело было найдено.
https://theaseanpost.com/article/mysterious-death-nora-quoirin
Т.е., умерла раньше, чем попала в это место.

Цитирование
Бывший главный детектив-инспектор столичной полиции Питер Киркхем сказал, что следователи должны работать над каждой теорией, которая соответствует фактам и всем оставшимся возможностям, пока не будут найдены веские доказательства, чтобы исключить их.
А нам говорят, что нужно придерживаться самой простой версии: "была чокнутой - значит, сама ушла". Требуется игнорировать любые неувязки и даже не думать о других версиях. Иначе приравняют к тем, кто носит шапочки из фольги...

Она - не чокнутая: у неё голопрозэнцефалия - мозг не разделён на полушарии. Может ли такой человек, имея нарушения координации, не падая, передвигаться по труднопроходимым местам НОЧЬЮ, в темноте? К сожалению, нет ни высказываний её врачей, ни видеозаписей на которой можно было бы увидеть то, как она передвигается... А несогласие родителей с малайзийской версией объясняют тем, что они "убиты горем"... Их глупость - в том, что они делают упор на застенчивости, а не на слабых возможностях, связанных с плохой координацией и ориентированием.

"Замечательное" объяснение от "здравомыслящих": кишечное кровотечение у неё от того, что она мусора наелась (а некоторые - "нябось, камни глотала"!) ... По результатам вскрытия, ни о каком мусоре не заявлялось! Малайзийцами утверждалось, что кровотечение и перфорация возникли из-за голода и стресса! Но голод и стресс не приводят к язве и перфорации, тем более - так быстро...
« Последнее редактирование: 17.05.20 13:27 »

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #43 : 26.05.20 14:25 »
Дэвид предполагает как раз версию порталов, аномалий в пространстве-времени, возникающих в местах залегания кварца, который и открывает портал вследствие эффекта Казимира
Умница Дэвид! Просто молодец, серьезно.

в растворение в воздухе никто бы не поверил,
Между тем, именно в это и нужно верить. Вон, как японский студент растворился, только мобила и осталась.
« Последнее редактирование: 27.05.20 09:19 »

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #44 : 26.05.20 14:33 »
Вне законов физики любую ахинею придумать можно. Попробуй что-то дельное предложить, не нарушая их.
Камень, который отвергли строители, сделался главою угла.

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #45 : 26.05.20 14:38 »
Вне законов физики любую ахинею придумать можно. Попробуй что-то дельное предложить, не нарушая их.
К счастью, наши законы физики не имеют абсолютной силы :)

Несчастные потеряшки стали жертвой злонамеренного существа, располагающего определенными возможностями.
« Последнее редактирование: 26.05.20 14:38 »

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #46 : 27.05.20 09:03 »
К счастью, наши законы физики не имеют абсолютной силы :)

Несчастные потеряшки стали жертвой злонамеренного существа, располагающего определенными возможностями.
А можно поподробнее, про какое существо и про каки законы физикиимели ввиду?
Камень, который отвергли строители, сделался главою угла.

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #47 : 27.05.20 09:18 »
А можно поподробнее, про какое существо
Сказочное. Можно даже сказать, мифологическое. Владеющее суггестией и способное открывать проход в т. н. "квантовый карман", где оно обитает.

Цитирование
и про каки законы физикиимели ввиду?
Те самые, которые вы упоминали в своем первом сообщении  ;)

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #48 : 27.05.20 10:59 »
Сказочное. Можно даже сказать, мифологическое. Владеющее суггестией и способное открывать проход в т. н. "квантовый карман", где оно обитает.
Те самые, которые вы упоминали в своем первом сообщении  ;)
А как по вашему, реликтовый гоминоид без квантовых карманов существовать может?
Камень, который отвергли строители, сделался главою угла.

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #49 : 27.05.20 12:48 »
А как по вашему, реликтовый гоминоид без квантовых карманов существовать может?
Понятия не имею, т. к. не разбираюсь в "реликтовых гоминоидах". Эту тварь нужно ловить на живца: выпускать добровольцев, облепленных датчиками с ног до головы, и фиксировать нездоровые паттерны их перемещения. В противном случае, г-н Паулидес рискует отснять еще сотню-другую серий про таинственные исчезновения.

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #50 : 27.05.20 16:49 »
Вопрос был о нарушении законов физики. Реликтовый гоминоид в этом смысле безупречен как человек или лось. Вы с этим согласны?
Камень, который отвергли строители, сделался главою угла.

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #51 : 27.05.20 17:42 »
Вопрос был о нарушении законов физики.
Какие законы оказались нарушены?

Цитирование
Реликтовый гоминоид в этом смысле безупречен как человек или лось. Вы с этим согласны?
Как можно быть согласным с абсурдным утверждением?

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #52 : 27.05.20 17:56 »
Какие законы оказались нарушены?
Речь о законах, распространяющихся на всех... *JOKINGLY*
например, закон всемирного тяготения, законы массы тела или материи (хотя бы в обывательском понимании, физическое тело не может существовать одновременно в разных местах пространства)
Цитирование
Как можно быть согласным с абсурдным утверждением?
Которое из утверждений вы имели ввиду?
« Последнее редактирование: 27.05.20 17:56 »
Камень, который отвергли строители, сделался главою угла.

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #53 : 27.05.20 21:52 »
Речь о законах, распространяющихся на всех...
И где же они нарушены?

Цитирование
Которое из утверждений вы имели ввиду?
А вы?

Инна368


  • Сообщений: 1 449
  • Благодарностей: 601

  • Расположение: Москва

  • Была 18.07.20 23:17

Missing 411
« Ответ #54 : 27.05.20 22:00 »
Missing 411 ... я много чего пересмотрела на ютубе из этой серии , но почему то ни разу мне не приходило в голову , что здесь замешан СЧ... Сергей , КАК Вам подобная мысль пришла в голову ? Там скорей криминал в различных видах , чем СЧ ...
Старый ник Инна369

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #55 : 28.05.20 07:56 »
Missing 411 ... я много чего пересмотрела на ютубе из этой серии , но почему то ни разу мне не приходило в голову , что здесь замешан СЧ... Сергей , КАК Вам подобная мысль пришла в голову ? Там скорей криминал в различных видах , чем СЧ ...
Сейчас многое из его деятельности подчистили. Если вы смогли бы ознакомиться с его материалами несколько лет ранее, вы бы увидели, что он непосредственно занимался темой сасквотчей и ездил с рейнджерами нац. парков именно в поисках их следов. Если я верно запомнил, кажется он сам наблюдал сасквотча издалека. В его арсенале есть свидетельство, что некто из очевидцев видел в волосах сасквотча цветную резинку пропавшего ребенка.
Площадки, на которых это писалось, пару лет назад были удалены, но возможно стоит еще поискать конференции его в youtube, (ссылки были в моей или параллельной темах за 16 или 17 год, но это очень непросто!)

Добавлено позже:
И где же они нарушены?
Я считаю, что существование СЧ в природе не нарушает никаких законов физики.
« Последнее редактирование: 28.05.20 07:57 »
Камень, который отвергли строители, сделался главою угла.


Поблагодарили за сообщение: Инна368

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #56 : 28.05.20 08:23 »
Я считаю, что существование СЧ в природе не нарушает никаких законов физики.
Я тоже так считаю, хотя никогда не изучал сасквотчей.

Хочу отметить, что агрессивное нападение с целью убийства не является нормальным поведением для т. н. "сказочных существ". Грубо говоря, леший не будет вас убивать только за то, что вы переночуете на его любимой поляне. Вполне возможно, что тварь - не эндемик, а залетная.

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #57 : 28.05.20 08:41 »
Я тоже так считаю, хотя никогда не изучал сасквотчей.

Хочу отметить, что агрессивное нападение с целью убийства не является нормальным поведением для т. н. "сказочных существ". Грубо говоря, леший не будет вас убивать только за то, что вы переночуете на его любимой поляне. Вполне возможно, что тварь - не эндемик, а залетная.
Опустите термин сказочное существо, иначе, если у вас отношение к СЧ как к фольклору, не имеет смысл обсуждать народное творчество.
Каждое новое название говорит только о местном диалекте. Например, по народному птичка назыаается малиновка, в энциклопедии - зарянка. Речь идет об одном и том же существе и об одном и том же виде. Также и со СЧ: в науке принято называть реликтовый гоминоид, по-народному существует много названий, таких, как леший или куль или шурале или воршуд, это сущности не меняет. Название отражает местный диалект, обозначающий <существо (дикий человек)> + <место обитания (у одних народов в горах, у других в болотах, у третьих в лесу и от этого название меняется)>

По поводу агрессии СЧ - почитайте источники: Быкову, Поршнева, Макарова, Трахтенгерца. В одних случаях они ведут себя довольно мирно, в других прячатся, могут вести себя и опасно. Криптозоологи не рекомендуют при встрече со СЧ вести себя развязно или беспечно. Существо дикое, пугливое, но не чуждое животных агрессивных моментов. Рассказ того, кого СЧ задушил на своей любимой поляне, мы вряд ли услышим.
« Последнее редактирование: 28.05.20 08:44 »
Камень, который отвергли строители, сделался главою угла.

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #58 : 28.05.20 13:39 »
Опустите термин сказочное существо, иначе, если у вас отношение к СЧ как к фольклору, не имеет смысл обсуждать народное творчество.
Я считаю всех фольклорных существ сугубо реальными. Нельзя гарантировать, что в таинственных исчезновениях виноват именно сасквотч.

Мне известна схема, по которой происходят эти исчезновения, а уж кто за ними стоит - надо выяснять.

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #59 : 28.05.20 15:32 »
Согласен. Но некоторые пропажи детей уж очень нарочито смахивают на истории, дошедшие до нас из глубины веков о воровстве детей "лесными".
Люди шумят, ничего вокруг не замечают, потом раз - и ребёнок пропал. Не надо придумывать сложных схем о бесмысленном похищении городскими злоумышленниками, прятавшимися за кустами.
Камень, который отвергли строители, сделался главою угла.

tol2013


  • Сообщений: 2 390
  • Благодарностей: 1 236

  • Был 07.08.20 16:28

Missing 411
« Ответ #60 : 28.05.20 16:34 »
Мне известна схема, по которой происходят эти исчезновения,
Поделитесь ею с нами?

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #61 : 30.05.20 12:47 »
Поделитесь ею с нами?
Разумеется.

Если вкратце, то сначала жертву цепляют мощной суггестией, отключающей волю практически полностью. (В этом состоянии вы можете жрать муравейник, искренне считая, что перед вами кремовый торт). Затем ее аккуратно уводят в удобное для хищника место, подальше от других людей, если они есть. В удобном месте жертва пересекает невидимую границу и попадает в т. н. "квантовый карман" - соседнее с нашей реальностью место, где действуют законы его создателя. Продвигаясь вглубь кармана, жертва попадает в логово хищника, где с ней происходят разные неприятные вещи.

Из "квантового кармана" невозможно ни докричаться голосом, ни дозвониться по телефону. Можно только выйти, причем точно так же, как вы зашли (и если вас еще выпустят). К сожалению, суггестия настолько сильна, что жертва не имеет силы сопротивляться зову и вообще не понимает, что идет куда-то не туда. Миг прозрения наступает в логове. но тогда бывает уже слишком поздно.

Меня в этой истории смущает другое. Ни одно существо в этом мире не имеет права немотивированно убивать другое (т.е. иначе как охотясь для пропитания). На сказочные существа это правило тоже распространяется. Ни лешие, ни черти не могут вас растерзать просто потому, что вы им не понравились. Довести до самоубийства - возможно, но напасть напрямую - никогда. Что это за тварь такая, для которой мы являемся кормовой базой (легальным объектом охоты), откуда она к нам попала и почему столько времени бесчинствует - всё это вопросы без ответов.

Выжившие говорят об этом так:

"Перед тем, как я нагнулся, я имел возможность видеть, как почти вся группа поднимается вверх по склону примерно в 60 метрах от меня, а позади меня был поворот на тропу, по которой мы шли, и по ней к моей точке поднималось еще 2 или 3 человека. Я быстро завязал шнурки, все сделал как надо и я, подчеркиваю, нисколько не менял направление своего тела во время этого процесса.

Но когда я встал, я тут же увидел, что тропа, по которой мы шли, исчезла и вместо нее была обычная почва с упавшими листьями. И что самое жуткое, я не видел никаких людей ни впереди себя, ни идущими позади меня. И даже поворота у скалы позади меня не было.

Что еще смутило, так это отсутствие звуков. Не было слышно ни порывов ветра, ни пения птиц, ни беличьего писка или иных лесных шумов. Все было очень странным и неестественным. И тут же я ОЩУТИЛ, что на меня кто-то смотрит. Это ощущение быстро переросло во что-то большее - я был уверен, что за мной пристально следит тот, кто хочет нанести мне вред, что оно очень злое и насильственное. И что оно приближается ко мне.

Я настолько тонко ощутил, что сначала оно медленно подползало ко мне, а потом кинулось ко мне бегом, что сам со всей силы побежал куда глаза глядят, мое тело само выбрало направление. И внезапно выскочил из-за деревьев прямо на тропу, по которой шли мои однокурсники.

Это место находилось на расстоянии 20-25 минут ходьбы от того места, где я остановился завязывать шнурки, при этом по моим ощущениям между тем, как я остановился, и тем как я выскочил на тропу, прошло не более 5 минут.

Меня тут же окружили и стали спрашивать что случилось, но я не знал, что и сказать. Я и сейчас не знаю, как это объяснить и я до сегодняшнего дня больше не хожу в лес в одиночку, даже в тот лес, что совсем рядом с домом моих родителей".
« Последнее редактирование: 31.05.20 08:38 »


Поблагодарили за сообщение: Sergei_VL

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #62 : 31.05.20 03:43 »
Цитирование
И внезапно выскочил из-за деревьев прямо на тропу, по которой шли мои однокурсники.
Это место находилось на расстоянии 20-25 минут ходьбы от того места, где я остановился завязывать шнурки, при этом по моим ощущениям между тем, как я остановился, и тем как я выскочил на тропу, прошло не более 5 минут.
Т.е., получается, что за это время однокурсники прошли соответствующее расстояние, и он тоже оказался рядом с ними?

Если убрать мистику, то и получится, что он продолжал идти за однокурсниками, но при этом спал и видел сон. В таком же состоянии человек может уйти совсем в другое место, заблудиться и погибнуть. Гипнотизирует сама местность, со всеми её особенностями...

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #63 : 31.05.20 08:40 »
Если убрать мистику
Это не мистика, а физика. Квантовая.

Цитирование
то и получится, что он продолжал идти за однокурсниками, но при этом спал и видел сон.
И продолжал играть на кларнете, решая в уме дифуры.

Самому-то не смешно?

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #64 : 31.05.20 08:52 »
Это не мистика, а физика. Квантовая.
Одни фантазии вокруг неё. Где тут воспроизводимые эксперименты?

Цитирование
Самому-то не смешно?
Амбулаторный автоматизм? Читать об этом - прикольно, а испытывать на себе как-то не хочется...

Цитирование
Амбулаторные автоматизмы проявляются в виде автоматизированных действий, совершаемых больными при полной отрешённости от окружающего. Выделяют оральные автоматизмы (приступы жевания, причмокивания, облизывания, глотания), ротаторные автоматизмы («vertigo») с автоматическими однообразными вращательными движениями на одном месте. Нередко больной, будучи отрешённым от окружающей действительности, автоматически стряхивает с себя что-то. Иногда автоматизмы бывают более сложными, например больной начинает раздеваться, последовательно снимая с себя одежду. К амбулаторным автоматизмам относятся и так называемые фуги, когда больные, находясь в состоянии помрачённого сознания, бросаются бежать; бегство продолжается некоторое время, а затем больные приходят в себя. При состояниях амбулаторного автоматизма известны случаи длительных миграций (трансы), однако чаще эти блуждания бывают сравнительно непродолжительными и выражаются в том, что больные проезжают нужную им остановку, проходят мимо своего дома и т. д.

 Могут совершать бессознательные путешествия по улице, притом довольно продолжительные: известен случай путешествия больного из Мумбаи (Бомбея) в Калькутту в состоянии амбулаторного автоматизма
Амбулаторный автоматизм, как и другие сумеречные помрачения сознания, связаны с эпилепсией, а она провоцируется такими вещами, как мерцания, и на этом даже основывается тест на эпилепсию. В условиях леча, мерцание света между стволами - обычное дело. Но и другие подобные вещи могут провоцировать...
« Последнее редактирование: 31.05.20 09:12 »

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #65 : 31.05.20 09:12 »
Одни фантазии вокруг неё.
Мои слова - плод сбора и анализа аналогичных случаев.

Цитирование
Где тут воспроизводимые эксперименты?
Как предлагаете их ставить?

Цитирование
Амбулаторный автоматизм? Читать об этом - прикольно, а испытывать на себе как-то не хочется...
Ваши попытки подогнать обычные объяснения под необычные события вгоняют меня в грусть-тоску.
« Последнее редактирование: 31.05.20 09:13 »

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #66 : 31.05.20 09:14 »
Как предлагаете их ставить?
Если нельзя провести опыт, то это - фантазии, а не физика. Тем более, самих существ никто приборами не фиксировал, и науке они неизвестны.

Цитирование
Ваши попытки подогнать обычные объяснения под необычные события вгоняют меня в грусть-тоску.
Что же там необычного? Объясняется замечательно, вплоть до увязки возникновения приступа с мерцанием света между деревьями. Но могут быть и другие раздражители: возможно - монотонные звуки, монотонные пейзажи и прочее подобное. Белое поле тундры, северное сияние - тоже... Видимо, эти люди были склонны к таким расстройствам, поэтому не у всех возникает.

Цитирование
Мои слова - плод сбора и анализа аналогичных случаев.
А зачем объяснять чем-то потусторонним, если есть подходящие психические расстройства, а в этих ситуациях даже провоцирующие их факторы присутствуют?

В принципе, тут могут быть и другие похожие состояния, которые провоцируются этими же факторами. Можно, например, сравнить с тем, как водители засыпают за рулём. Бывают случаи, когда во время долгих телефонных разговоров человек засыпает, и начинает всякую чушь нести: явно - что-то из начавшихся у него сновидений.

Был забавный случай: во время разговора положила трубку, чтобы отойти на время, а когда вспомнила - прошло часа 2, а человек там, как робот, повторял одну фразу :)
« Последнее редактирование: 31.05.20 09:31 »

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #67 : 31.05.20 09:47 »
Если нельзя провести опыт, то это - фантазии, а не физика. Тем более, самих существ никто приборами не фиксировал, и науке они неизвестны.
Далеко не всё в этом мире можно изучить опытным путем. Шаровую молнию, например, пока нельзя.

План эксперимента по выявлению твари я уже предлагал. Пускаем бродить наживку в местах исчезновения, ставим на нее датчики движения тела и конечностей. Как только паттерн станет нездорово целенаправленным, едем выручать. Правда, рискуем не успеть - нужен боевой дрон.

Цитирование
Что же там необычного? Объясняется замечательно, вплоть до увязки возникновения приступа с мерцанием света между деревьями.
Подгонка научных объяснений под необъяснимые случаи - это путь в никуда. Люди так и будут пропадать, а вы будете верить в грезы наяву.

Цитирование
А зачем объяснять чем-то потусторонним, если есть подходящие психические расстройства, а в этих ситуациях даже провоцирующие их факторы присутствуют?
Затем, что статистика - бессердечная штука. Когда я натыкаюсь на идентичные случаи в пятый, десятый, 25-й раз, у меня возникает четкое понимание происходящего.

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #68 : 31.05.20 11:38 »
Мартин Добров, как не верить, если существуют психушки, а в них - пациенты с подобными и ещё более странными состояниями, типа онейроидного синдрома и синдрома Котара :)

Цитирование
Амбулаторные автоматизмы

Проявляются автоматическими действиями. Больные способны в период расстройства совершать сложные двигательные акты: покупать билеты на автобус или другой транспорт, отправиться в магазин и др. При этом, когда человек приходит в себя, он не понимает каким образом оказался в данном месте. Это связано с развитием полной амнезии. При амбулаторных автоматизмах пациент внешне задумчив, растерян и воспринимается окружающими людьми как здоровый человек. Аналогичные изменения характерны для транса, но, его длительность может достигать нескольких суток.
« Последнее редактирование: 31.05.20 11:56 »

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #69 : 31.05.20 11:56 »
как не верить, если существуют психушки, а в них - пациенты с подобными и ещё более странными состояниями, типа онейроидного синдрома и синдрома Котара
В личном архиве Паулидеса - примерно полторы тысячи исчезновений. Он всю карту Америки точечками истыкал и всю голову себе сломал, пытаясь найти ответ.

Вы, конечно, можете всё огульно валить на горячечный бред. Переубеждать вас я, конечно, не буду.

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #70 : 31.05.20 12:03 »
Мартин Добров, просто, я даже не нахожу случаев, которые не укладываются в эту теорию, и при этом - не объясняются другими известными вещами (преступления, нападения зверей, получение травм, замерзание и т.п.). Объясняется и то, что человек раздевается - даже в ситуациях, когда условия не подходят для "парадоксального раздевания" при гипотермии (например, в теплую погоду, как в случае с японским студентом). И ещё одна причина - суицид: человек может и специально пойти в красивое место (или - легендарное, как "лес самоубийц" в Японии), а может там принять решение "не возвращаться". Кстати, и про лес самоубийц ходят легенды, что некоторые именно там принимают решения (как водится - "под влиянием духов").

И я думаю, что во многих случаях, когда считается, что человек просто заблудился, имело место подобное расстройство. Кстати, могут быть почти неотличимые случаи! Например, одна выжившая рассказывала, что шла по дорожке, потом отошла в лесок, села на бревно, поела, а потом вдруг поняла, что не помнит, с какой стороны да дорожка, по которой она шла! Это тоже - какие-то "игры разума"...

Про плохую подготовку - просто отговорка: например, был случай, когда пропал сам проводник! Вёл группу, а потом куда-то исчез, незаметно для всех.
« Последнее редактирование: 31.05.20 12:21 »

Grimm


  • Сообщений: 641
  • Благодарностей: 139

  • Расположение: SPB

  • Был вчера в 17:53

Missing 411
« Ответ #71 : 31.05.20 12:28 »
Мартин Добров, как не верить, если существуют психушки, а в них - пациенты с подобными и ещё более странными состояниями, типа онейроидного синдрома и синдрома Котара :)
Но в психушках полно тех, кто до сих пор "воюет". Если бы вы не знали о войне, то тоже посчитали бы, что ее нет так как о ней говорят (условно) сумасшедшие? Не очень сильный аргумент.

Добавлено позже:
В личном архиве Паулидеса - примерно полторы тысячи исчезновений.
Поставьте эксперимент на себе. Сейчас, в эпоху спутникового геопозиционирования, мобильных телефонов и камер все это не проблема. Настройте тел. так, чтобы, как только перестают ловиться спутники (во время эксперимента) начинала выть сирена. Подумайте о защите от внушения и - в путь)
Но полторы тысячи "квантовых карманов", согласитесь, тоже перебор.
« Последнее редактирование: 31.05.20 12:29 »

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #72 : 31.05.20 15:53 »
Мартин Добров, просто, я даже не нахожу случаев, которые не укладываются в эту теорию
Вероятно, вы пропускаете неудобные фрагменты. Например:

Во многих случаях люди возвращались в довольно чистой одежде, и даже несмотря на обильные осадки, они были сухими. По-настоящему удивительным фактором является то, что во многих случаях не было найдено никакого укрытия, и никто не мог объяснить, почему жертва была сухой.

В некоторых случаях человек пропадает в одном месте, а обнаруживается в другом, и довольно далеко. Даже крупный хищник не будет тащить на себе 80-100 кило мяса неведомо куда.

Поставьте эксперимент на себе. Сейчас, в эпоху спутникового геопозиционирования, мобильных телефонов и камер все это не проблема. Настройте тел. так, чтобы, как только перестают ловиться спутники (во время эксперимента) начинала выть сирена. Подумайте о защите от внушения и - в путь)
Заниматься этим без подстраховки - верная гибель. "Подумайте о защите от внушения" - далеко не факт, что она есть. Такого рода суггестия действует на глубочайшие отделы мозга. Под таким внушением человек может грызть себе руки, ощущать нечеловеческую боль, но не прекращать самоубийственный акт.

Цитирование
Но полторы тысячи "квантовых карманов", согласитесь, тоже перебор.
Это сырая база случаев за довольно длительный период. Я же говорю - кто-то охотится.
« Последнее редактирование: 31.05.20 17:30 »

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #73 : 01.06.20 00:37 »
Меня в этой истории смущает другое. Ни одно существо в этом мире не имеет права немотивированно убивать другое (т.е. иначе как охотясь для пропитания). На сказочные существа это правило тоже распространяется. Ни лешие, ни черти не могут вас растерзать просто потому, что вы им не понравились. Довести до самоубийства - возможно, но напасть напрямую - никогда. Что это за тварь такая, для которой мы являемся кормовой базой (легальным объектом охоты), откуда она к нам попала и почему столько времени бесчинствует - всё это вопросы без ответов.
Может и имеет право, кто это может судить? Это только наша точка зрения. А медведь имеет моральное право нам череп пополам раскусить? Нет, конечно. Сволочь, это же не гуманно!... Тысячелетия назад в мире водились разные виды гоминид, возможно происходила межвидовая борьба за главенствующее положение. Ясный перец - победил слабейший. И хоть я не считаю СЧ неандертальцем, тем не менее, давайте представим, что может испытывать к нам потомок неандертальцев, не похожий на нас и одновременно чем-то похожий, никак не желающий примкнуть и раствориться в нашем виде, не умеющий и не желающий говорить по человечьи? Вынужденный прятаться по не самым приятным местам. От кого прятаться? Да от нас.
Камень, который отвергли строители, сделался главою угла.

Инна368


  • Сообщений: 1 449
  • Благодарностей: 601

  • Расположение: Москва

  • Была 18.07.20 23:17

Missing 411
« Ответ #74 : 01.06.20 01:48 »
Возьмём пункт 3 - собаки не берут след пропавшего
Вопрос: сможет ли собака следовать за незнакомым тошноиворным неприятным ей запахом, перебивающим и не имеющим отношения к запаху того, кого ей надо искать?
Вот тут могу добавить один момент... присутствие запаха СЧ у собак вызывает чувство страха ... а если она просто теряет след не проявляя страха и беспокойства , то значит запаха СЧ нет... Вот на перевале Д был страх у собак , причем очень сильный ..., а  в случае с пропавшем ( с концами) мальчике из этой серии ( миссинг411), есть просто замечание о том , что собаки потеряли след и все... о проявлении страха у них ничего нет...и так же в других случаях..
« Последнее редактирование: 01.06.20 02:02 »
Старый ник Инна369

Grimm


  • Сообщений: 641
  • Благодарностей: 139

  • Расположение: SPB

  • Был вчера в 17:53

Missing 411
« Ответ #75 : 01.06.20 06:34 »
Заниматься этим без подстраховки - верная гибель. "Подумайте о защите от внушения" - далеко не факт, что она есть. Такого рода суггестия действует на глубочайшие отделы мозга. Под таким внушением человек может грызть себе руки, ощущать нечеловеческую боль, но не прекращать самоубийственный акт.
Это сырая база случаев за довольно длительный период. Я же говорю - кто-то охотится.
Я не предлагаю вам пытаться поставить эксперимент одному. Пару единомышленников, уверен, вы найдете. Я предлагаю вам быть наживкой. Ваша идея, вам ее и воплощать.
Против внушения можно использовать другое внушение (перед ним). С кодовым словом. Не зная его, снять его не удастся. В том числе и другим внушением. Но это только как вариант.
Кроме того, вы можете настроить автоматику так, что она будет реагировать на изменение вашего поведения или показателей. По моему, нет ничего нерешаемого. Ну, а если вы хоть в чем-то правы, то стопроцентной гарантии безопасности вам никто не даст. Тем более если какие-то правительственные или "общественные" организации с этим связаны на взаимовыгодных условиях.
Но пару аномальных зон вы вполне могли бы (при наличии средств) исследовать. И да, кто-то, возможно, охотится. Но прежде чем предполагать такую экзотику как КК, можно предположить подземные пещеры и т.п. Связь там пропадает так же. И одежда будет сухой. Т.е. на надо концентрироваться на каком-то одном предположении.

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #76 : 01.06.20 11:18 »
Но прежде чем предполагать такую экзотику как КК, можно предположить подземные пещеры и т.п. Связь там пропадает так же. И одежда будет сухой. Т.е. на надо концентрироваться на каком-то одном предположении.
Если б дело было в подземных пещерах, то потеряшек находили бы именно там.

Grimm


  • Сообщений: 641
  • Благодарностей: 139

  • Расположение: SPB

  • Был вчера в 17:53

Missing 411
« Ответ #77 : 01.06.20 18:51 »
Если б дело было в подземных пещерах, то потеряшек находили бы именно там.
Но многих и не находят. К чему сразу предполагать "параллельные миры"? Если вы предполагаете внушение, то пещеры подходят по многим параметрам. Тишина там тоже будет полная, что и отметил вышедший (частично) из состояния наведенного сна. И, как вы понимаете, достаточно сказок, где подземный мир описывается крайне негативно. Так что отбрасывать версию с подземными (карстовыми, искусственными и т.д. и т.п.) полостями (ходами, туннелями..) странно.

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #78 : 02.06.20 13:25 »
Я считаю, что по логике не может быть всяких энергетических карманов, ловушек, дырок в пространстве, временных аномалий и т.д.
Также не совсем понятен вопрос с разными потусторонними существами.
Нет пространственных порталов в городах, тут люди пропадают потому что их похищают.
То же самое в лесной или пустынной местности. Все эти аномальные объяснения - кажется продукт работы мозга человека, не имеющий подтверждения в законах природы. В отличие от снежного человека, которого видело достаточно много народу по миру. Гипнозом, сугессией он обладает, заморочить человека может, как и похитить. Но причем, извините, тут порталы? У СЧ есть места обитания, подземные убежища, свои тропы. И человека могут похитить или убить, хотя в основном, конечно избегают. Не надо нарушать законов физики и биологии. Высокий прямоходящий обволошеный примат.
Камень, который отвергли строители, сделался главою угла.

Grimm


  • Сообщений: 641
  • Благодарностей: 139

  • Расположение: SPB

  • Был вчера в 17:53

Missing 411
« Ответ #79 : 02.06.20 18:20 »
Все эти аномальные объяснения - кажется продукт работы мозга человека, не имеющий подтверждения в законах природы. В отличие от снежного человека, которого видело достаточно много народу по миру. Гипнозом, сугессией он обладает, заморочить человека может, как и похитить. Но причем, извините, тут порталы?... Высокий прямоходящий обволошеный примат.
Вы необоснованно сводите "эффект СЧ" к реликтовому гоминиду. Или тогда на каком основании вы отказываете в эволюции "примату" (не обезьяне), столько тысяч лет находящемуся во взаимодействии с человеком? Мы и о человеческой-то цивиллизации мало что знаем. Знаем, что что-то было, но исчезло 11 т.лет до нашей эры, или 5 т.л... А тут - параллельная ветвь,  конкурирующий вид,  по вашим словам.

ТТТТ


  • Сообщений: 175
  • Благодарностей: 77

  • Был 16.07.20 06:17

Missing 411
« Ответ #80 : 07.06.20 03:00 »
В большинстве случаев причины очень земные. ВэйС на днях упомянул в другой ветке о заброшенных выработках. Видел я в детстве шурфы оставленные геологами. С учётом того, что многие рудники и шахты практически позаростали, что говорить о глубокой дыре в земле? Ограда либо сгнила за 30-70 лет, либо её использовали для более насущных целей в хозяйстве. Можно идти по пояс в траве, и влетететь в такую западню - на ровном месте, солнечным днём. Результат - смерть, или тяжелейшая травма, шансов выбраться - близко к нулю.

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #81 : 09.06.20 01:56 »
Вы необоснованно сводите "эффект СЧ" к реликтовому гоминиду. Или тогда на каком основании вы отказываете в эволюции "примату" (не обезьяне), столько тысяч лет находящемуся во взаимодействии с человеком? Мы и о человеческой-то цивиллизации мало что знаем. Знаем, что что-то было, но исчезло 11 т.лет до нашей эры, или 5 т.л... А тут - параллельная ветвь,  конкурирующий вид,  по вашим словам.
Обезьянка не может так хорошо знать человеческое сознание, чтобы при встрече уметь управлять им. Но при этом и подход к СЧ как к чему-то нематериальному я считаю неверным.
Камень, который отвергли строители, сделался главою угла.

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #82 : 10.06.20 21:00 »

Посмотрел фильм Дэвида Vanished (2019), похоже он таки на чём-то остановился в прошлом году. В своих интервью радио Coast to Coast он обычно ничего не говорил о своих версиях исчезновения людей, только по-моему упомянул, что версия вмешательства правительства и действия серийного убийцы им исключены.

... Дэвид в фильме сказал, что пропавших, соответствующих его критериям у него уже более 1600 (на момент съемки фильма).
Ну ладно правительство  - тут хоть включай, хоть исключай это споры на пустом месте. Но а маньяков-то интересно почему он исключил из числа подозреваемых в пропажах?!
Неужто из этих 1600 случаев ни один вот так прям под действия маньяка не попадает?! Да половина точно - особенно где пропали дети и легкие девушки, которых через плечо и бежать.
Или недалеко бежать - может где шурф, болото или шахта/пропасть рядом.

Меня в этой истории смущает другое. Ни одно существо в этом мире не имеет права немотивированно убивать другое (т.е. иначе как охотясь для пропитания). На сказочные существа это правило тоже распространяется. Ни лешие, ни черти не могут вас растерзать просто потому, что вы им не понравились. Довести до самоубийства - возможно, но напасть напрямую - никогда. Что это за тварь такая, для которой мы являемся кормовой базой (легальным объектом охоты), откуда она к нам попала и почему столько времени бесчинствует - всё это вопросы без ответов.
Ну, если вас только это смущает, то вы... э-э-э очень увлеченный своей идеей человек..

Меня, например, смущает, что вообще за право такое и кто его кому дал, что за правило, которое распространяется на сказочных существ - как я помню по всяким сказкам жрут они кого угодно напропалую, да и вообще мало ли тварей, которые являются кормовой базой для нас. У нас видимо право есть кем-то даденое..

Подгонка научных объяснений под необъяснимые случаи - это путь в никуда. Люди так и будут пропадать, а вы будете верить в грезы наяву.
Я вот вижу только подгонку фантазий под необъяснимые пока случаи пропаж.
1500 порталов и это только навскидку - не много ли?! На одну страну-то..
Если он нашу статистику капнет, то еще столько же, а то и больше нарисуется. А за 90-е там вообще один большой портал на всю страну видимо был - сколько народа бесследно пропало..
Подгонять ВСЕ пропажи людей под одно объяснение - вот это уже сказки чистой воды.

Вот тут могу добавить один момент... присутствие запаха СЧ у собак вызывает чувство страха ... а если она просто теряет след не проявляя страха и беспокойства , то значит запаха СЧ нет... Вот на перевале Д был страх у собак , причем очень сильный ..., а  в случае с пропавшем ( с концами) мальчике из этой серии ( миссинг411), есть просто замечание о том , что собаки потеряли след и все... о проявлении страха у них ничего нет... и так же в других случаях..
Я не специалист- собаковод, но вряд ли на свете существует хоть одно живое существо, которое у ВСЕХ собак, прям как закон, вызывает чувство страха.
Незнакомо, неприятно, может смущать - но чтобы прям все собаки мира запаха боялись...
Я еще могу понять предположение, что конкретная собака, которая как-то неудачно встретилась с СЧ боится его запаха, но все сразу-то что резко генетически вспоминают о своих предках, которые тысячу и более поколений назад с такими вот гоминоидами воевали?!

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #83 : 11.06.20 02:30 »
Меня, например, смущает, что вообще за право такое и кто его кому дал, что за правило, которое распространяется на сказочных существ
Возможно, вас это удивит, но следующие утверждения верны:

1. Внутривидовая агрессия никогда не кончается смертью. Даже сражаясь за самку, самцы не дерутся до смерти. Если двум стаям тесно, то одна уходит искать дичь в другом месте.

2. Межвидовая агрессия кончается смертью, когда мы имеем дело с охотой хищника на травоядное, которое является его привычным рационом. При этом будет выбита самая слабая особь. И лев не будет догонять охамевших гиен и ломать им хребты.

3. Никакое животное не будет охотиться на человека или нарываться на бой с ним. Исключения связаны с нарушением биологических режимов (медведь-шатун), возможной угрозой для детенышей (медведица с медвежатами) или нехорошее стечение обстоятельств (тигр-людоед, отведавший человечьего мяса)

Цитирование
Я не специалист- собаковод, но вряд ли на свете существует хоть одно живое существо, которое у ВСЕХ собак, прям как закон, вызывает чувство страха.
Все без исключения животные боятся нечистой силы. Если в кустах притаилось нечто, даже самый смелый пёс туда не полезет. Будет рычать, скалить зубы, топорщить шерсть - но стоять смирно.
« Последнее редактирование: 11.06.20 17:38 »

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #84 : 11.06.20 08:11 »
Возможно, вас это удивит, но следующие утверждения верны:
Да меня больше удивляет ваша привычка отвечать не не вопросы, которые вам задали...
Вопрос был про право!!

1. Внутривидовая агрессия никогда не кончается смертью. Даже сражаясь за самку, самцы не дерутся до смерти. Если двум стаям тесно, то одна уходит искать дичь в другом месте. Лев не будет догонять охамевших гиен и ломать им хребты.

2. Межвидовая агрессия кончается смертью, когда мы имеем дело с охотой хищника на травоядное, которое является его привычным рационом. При этом будет выбита самая слабая особь.
Это здорово, конечно, но вы как бы намекаете на какое-то существо, которое сидит в конце портала, заманивает туда несчастных грибников и туристов и жрет их..
Портал может вести в параллельный мир, в иное время, в другую Вселенную,  - при чем здесь поведение наших родных гиен и леопардов?!?!?
Это существо вообще может существовать по иным закона и копировать поведение тигра совершенно никому не обязано..

3. Никакое животное не будет охотиться на человека или нарываться на бой с ним. Исключения связаны с нарушением биологических режимов (медведь-шатун), возможной угрозой для детенышей (медведица с медвежатами) или нехорошее стечение обстоятельств (тигр-людоед, отведавший человечьего мяса)
Забыли еще болезни и травмы - так становятся людоедами крупные хищники, не могут охотится на привычную дичь потому и начинают нас кушать.

Но опять же - вы об этом портальном существе ничего не знаете - может оно нас расценивает как кормовую базу и убивает исключительно для пропитания. Это мы считаем себя царями природы, а у него небось иное мнение.

Все без исключения животные боятся нечистой силы. Если в кустах притаилось нечто, даже самый смелый пёс туда не полезет. Будет рычать, скалить зубы, топорщить шерсть - но стоять смирно.
Здрасьте... А нечистая сила - тьфу-тьфу-тьфу, откуда в рассуждениях взялась?!?!
Снежный человек при всех своих недостатках, хулиганских выходках и антиобщественном поведении вроде как к ней совершенно не принадлежит.. А разговор шел именно о реакции собак на СЧ.
Сказочные существа, о которых вы же раньше говорили, по большей части тоже к нечистой силе никакого отношения не имеют..

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #85 : 12.06.20 08:56 »
Да меня больше удивляет ваша привычка отвечать не не вопросы, которые вам задали...
Вопрос был про право!!
Я даю те разъяснения, которые считаю нужным дать.

Цитирование
вы как бы намекаете на какое-то существо, которое сидит в конце портала, заманивает туда несчастных грибников и туристов и жрет их..
Я не намекаю, а говорю прямо. Некая тварь охотится на людей, не боясь вообще никого.

Леший не будет вас задирать насмерть, если вы забредете на заповедную полянку.

Цитирование
при чем здесь поведение наших родных гиен и леопардов?!?!? Это существо вообще может существовать по иным закона и копировать поведение тигра совершенно никому не обязано..
Вы невнимательно меня читаете. Я сразу заподозрил, что эта тварь не эндемична нашей биосфере. Она чужая.

Цитирование
Но опять же - вы об этом портальном существе ничего не знаете - может оно нас расценивает как кормовую базу и убивает исключительно для пропитания.
Возможно, оно может кушать только людей. Тогда его поведение получает рациональное объяснение.

Цитирование
А нечистая сила - тьфу-тьфу-тьфу, откуда в рассуждениях взялась?!?! Снежный человек при всех своих недостатках, хулиганских выходках и антиобщественном поведении вроде как к ней совершенно не принадлежит.. А разговор шел именно о реакции собак на СЧ. Сказочные существа, о которых вы же раньше говорили, по большей части тоже к нечистой силе никакого отношения не имеют..
Я использую оборот "сказочные существа" как собирательное название для всех живых существ, не описанных биологической наукой.
« Последнее редактирование: 12.06.20 08:57 »

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #86 : 12.06.20 10:47 »
Я не намекаю, а говорю прямо. Некая тварь охотится на людей, не боясь вообще никого.
А чего ей бояться?!Она же сказочная (с)))))
И почему вы говорите, что это ОНА к нам попала ?!  В разрезе обсуждения порталов это может люди к ней попадают.

Сидит себе в другом измерении со своими правилами и ей регулярно еда попадает.
Леший не будет вас задирать насмерть, если вы забредете на заповедную полянку.
Чегой-то?!
Испугается нарушить  Кодекс поведения леших ?!
Откуда прям такая уверенность?!
Вон Змей Горыныч жрет и хрумкает всех, кто к нему попадает, да еще вылазки устраивает в деревни за девками и коровами.
И никто ему не указ.
Я сразу заподозрил, что эта тварь не эндемична нашей биосфере. Она чужая.
Вы молодец.
Но если вы это давно подозревали, то опять же - при чем здесь примеры поведения НАШИХ земных существ?!?!
Зачем эта куча пунктов про межвидовые популяции и прочее?!

Я использую оборот "сказочные существа" как собирательное название для всех живых существ, не описанных биологической наукой.
Ааааа. У вас своя терминология.. Впрочем, не удивительно.
А почему вы свою тварь никогда сказочной не называете ?!

А я вот использую канонические определения - сказочные существа это те, которые в сказках прописаны.

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #87 : 12.06.20 14:22 »
А чего ей бояться?!
Законов воздаяния, которые едины для всех.

Цитирование
И почему вы говорите, что это ОНА к нам попала ?!  В разрезе обсуждения порталов это может люди к ней попадают.
Тогда сохранились бы предания о злобных духах леса (ручьев, болот), которые пожирают неосторожных путников.

Цитирование
Откуда прям такая уверенность?!
Лесные духи могут озлиться на тех, кто лес губит. Чтобы вывести их из себя настолько сильно, нужно наворотить делов. И кстати, прецеденты были.

Цитирование
Вон Змей Горыныч жрет и хрумкает всех, кто к нему попадает, да еще вылазки устраивает в деревни за девками и коровами.
И никто ему не указ.
Так Змея давным-давно победили. И вообще, это далекие отзвуки совсем других событий.

Цитирование
Вы молодец. Но если вы это давно подозревали, то опять же - при чем здесь примеры поведения НАШИХ земных существ?!?!
Зачем эта куча пунктов про межвидовые популяции и прочее?!
Затем, что вы упорно не хотите понимать. Я могу объяснить еще 101 раз, если надо. Или 411 :)

Цитирование
А я вот использую канонические определения - сказочные существа это те, которые в сказках прописаны.
[пожимая плечами] Какая разница-то? Черти, лешие, бигфуты и СЧ - все по одной статье проходят.
« Последнее редактирование: 12.06.20 14:22 »

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #88 : 12.06.20 20:53 »
Законов воздаяния, которые едины для всех.
Вы сегодня мяса не ели?!
Если ели, то я поражаюсь вашей храбрости при написании этих строк .. )))

Тогда сохранились бы предания о злобных духах леса (ручьев, болот), которые пожирают неосторожных путников.
Ну так то есть такие придания, причем в большом количестве..
И названия всякие   - Чертов лес, Чертово болото, Чертово урочище и прочее..
Заходили туда путники и пропадали. Правда потом оказывалось, что там разбойники какие жили, но мы-то теперь знаем, что путники просто в порталы проваливались))

Лесные духи могут озлиться на тех, кто лес губит. Чтобы вывести их из себя настолько сильно, нужно наворотить делов. И кстати, прецеденты были.
Вы же понимаете, что этой фразой практически сломали всю концепцию лесоразработок, осушения болот, вырубки и заготовки древесины..
То есть ничего этого не было, потому что лесные духи этого бы не позволили делать. И прецеденты были! )))

Так Змея давным-давно победили. И вообще, это далекие отзвуки совсем других событий.
Паааачччему не доложили?!?!?

Нет, серьезно - победили какого-то одного Змей Горыныча, но ведь он не из воздуха взялся  - их как минимум в сказках три было . Добрыня одного завалил, Иван - дурак и еще Федор какой-то, не помню..
А если инородцев брать - принцев да Сигурдов с Георгиями разных, то драконов вообще под сотню наберется.

Так что вероятность существования еще десятка, да в параллельным мире весьма и весьма высока..

Затем, что вы упорно не хотите понимать. Я могу объяснить еще 101 раз, если надо. Или 411
Спасибо , цифровой код понял и поржал ))
Но не понимаю, потому что вы объясняете так - по законам и логике не нашего мира..
Чуждая нам тварь придерживается всеобщего Закона Правды.. Ну или какого там..

[пожимая плечами] Какая разница-то? Черти, лешие, бигфуты и СЧ - все по одной статье проходят.
Вы - еретик!!! =-O =-O =-O
Хоть бигфута оставьте в реальных существах - что он вам сделал?!?! Иностранец, всё-таки. Ладно уж нашего СЧ зачмырили.. :'(

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #89 : 16.06.20 09:49 »
Вы сегодня мяса не ели?!
Если ели, то я поражаюсь вашей храбрости при написании этих строк .. )))
Я не практикую ахимсу настолько последовательно. И я не веган.

Цитирование
И названия всякие   - Чертов лес, Чертово болото, Чертово урочище и прочее..
Заходили туда путники и пропадали. Правда потом оказывалось, что там разбойники какие жили, но мы-то теперь знаем, что путники просто в порталы проваливались
Может, разбойники пошаливали, но обычно - все-таки черти.

Цитирование
Вы же понимаете, что этой фразой практически сломали всю концепцию лесоразработок, осушения болот, вырубки и заготовки древесины..
То есть ничего этого не было, потому что лесные духи этого бы не позволили делать. И прецеденты были!
Есть большая разница - прийти в лес ради древесины, забрать ее и уйти (хотя это делается весьма варварским способом), и прийти в лес, чтобы бить дичь без разбора.

Цитирование
победили какого-то одного Змей Горыныча, но ведь он не из воздуха взялся  - их как минимум в сказках три было . Добрыня одного завалил, Иван - дурак и еще Федор какой-то, не помню.. А если инородцев брать - принцев да Сигурдов с Георгиями разных, то драконов вообще под сотню наберется.
Змей мог быть как метафорическим - символом тьмы, поглотившим солнце - так и реальным. Какой-нибудь сильный колдун или выживший динозавр.

Впрочем, это неважно.

Цитирование
Чуждая нам тварь придерживается всеобщего Закона Правды.. Ну или какого там..
Я в стопятый раз повторяю - не придерживается. Читайте мои сообщения внимательнее.

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #90 : 16.06.20 21:34 »
Я не практикую ахимсу настолько последовательно. И я не веган.
Законы воздаяния едины для всех (с)
Сегодня ты съел курицу, а завтра тварь из портала съела тебя.

Может, разбойники пошаливали, но обычно - все-таки черти.
Точно ОБЫЧНО черти?!
Я вот слышал, что это обычно пошаливал черный пудель Артемон..
Мало кто знает, но до знакомства с Мальвиной, он был замешан в похищениях людей...

Есть большая разница - прийти в лес ради древесины, забрать ее и уйти (хотя это делается весьма варварским способом), и прийти в лес, чтобы бить дичь без разбора.
Для лешего разницы явно нет - ибо в обоих случаях ты бесконтрольно уничтожаешь его среду обитания..
В принципе, в формате нашего разговора, я могу привести в пример и Энта из "Властелина колец", а чё бы и нет?!
Он расстроился именно из-за лесозаготовок Саромана..

Я не практикую ахимсу настолько последовательно. И я не веган.
Может, разбойники пошаливали, но обычно - все-таки черти.
Есть большая разница - прийти в лес ради древесины, забрать ее и уйти (хотя это делается весьма варварским способом), и прийти в лес, чтобы бить дичь без разбора.
Змей мог быть как метафорическим - символом тьмы, поглотившим солнце - так и реальным. Какой-нибудь сильный колдун или выживший динозавр.

Впрочем, это неважно.
В смысле неважно?!
Мы обсуждаем причины исчезновения людей в лесах и если в этом виноват колдун, Змей Горыныч или динозавр какой, то мы должны обсудить все версии..

Я в стопятый раз повторяю - не придерживается. Читайте мои сообщения внимательнее.
Да понял я -понял.
Тварь из портала не придерживается какого-то Кодекса поведения каких-то существ.  Она отступник.
Правда, далеко не все земные существа его придерживаются, но и они отступники.
И сказочные существа. Тоже ренегаты.
И реликтовые гоминоиды - ну этим вообще Закон не писан...

Да и вообще не ясно есть ли такой Кодекс, а если есть, то попадает ли тварь под него, и обязана ли вообще его соблюдать или по какому-то своему живет, может она дочь твари- депутата ?!?!
Но это мелочи.

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #91 : 19.06.20 12:14 »
Законы воздаяния едины для всех (с)
Сегодня ты съел курицу, а завтра тварь из портала съела тебя.
Курица - домашняя птица, разводимая в пищу. Это моя законная добыча.

У твари может быть только одно оправдание. Если мы - единственно возможная ее пища - то она не подпадает под действие закона воздаяния.

Цитирование
Может, разбойники пошаливали, но обычно - все-таки черти.
Точно ОБЫЧНО черти?!
Точно.

Разбойничков успокаивал местный воевода.

Цитирование
если в этом виноват колдун, Змей Горыныч или динозавр какой, то мы должны обсудить все версии..
Динозавр слишком крупный :) Колдун? Есть варианты проще, включая тысячу способов спрятать тело. Змей Горыныч, и вообще всякий Змей, пожирающий солнце, - это отзвуки прошлых событий.

Искомое существо не имеет логова в нашем мире, иначе его бы давным-давно нашли.
« Последнее редактирование: 19.06.20 12:14 »

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #92 : 24.06.20 18:29 »
Пожалуй, вброшу немного полезных сведений.

Давайте рассмотрим общие признаки, присущие этим загадочным исчезновениям людей (пропавших как в национальных парках, так и в крупных городах):

Интересным фактом является то, что официальные власти и СМИ похоже стараются скрывать масштаб и детали исчезновений. Дэвид Полидес описывает в своих книгах, как он неоднократно пытался воспользоваться законом о свободе информации и получить от службы национальных парков США списки пропавших без вести. Каждый раз с него либо требовали баснословные суммы за эти списки, либо говорили, что таких списков не существует в природе! Довольно подозрительным является также тот факт, что несмотря на противоречивые факты официальной версией всегда был "несчастный случай" или "самоубийство". Кстати официальным вердиктом в случае с найденной мёртвой Элизой Лэм также был: "несчастный случай в результате утопления"! Очевидно, что власти знают намного больше, чем они признают. Но что же они пытаются от нас скрыть? Может быть природу тех сущностей, которые похищают людей и водят за нос озадаченных сыщиков? Кто играет в кошки-мышки с человеческой расой?

- Множество исчезновений происходили вблизи кустов с ягодами и больших гранитных глыб.
- Тела пропавших часто находили в воде (в реках, прудах, водоёмах, болотах и даже в пересохших ручьях), поэтому официальное заключение о причине смерти часто звучало как "утопление", несмотря на то, что многие другие факты, говорящие против этого.
- Полное отсутствие свидетелей исчезновения. Пропавшие часто просто растворялись в воздухе в нескольких метрах от своих родителей/друзей, однако никто не видел самого момента исчезновения.
- Пропавших часто находили в труднодоступных местах очень далеко от места исчезновения. Например, тела нескольких детей возрастом до 5 лет находили на склоне высоких гор, куда даже опытным альпинистам не было возможно добраться. Или вспомните известный случай исчезновения Элизы Лэм: её тело было найдено на запертой крыше отеля (на которой была установлена сигнализация и несколько камер видеонаблюдения) в закрытой (!) водоцистерне, к которой можно было добраться лишь с помощью приставной лестницы.
- Жертвы, найденные замёрзшими во льду, находились в вертикальном положении (!). У некоторых жертв голова и плечи находились над поверхностью льда.
- В большинстве случаев многие факты указывают на то, что жертвы не находились в течение всего периода пропажи в воде (об этом часто свидетельствует нехарактерный (минимальный) уровень разложения трупа), несмотря на то, что тела были найдены в воде. Это также противоречит официальным заключениям об "утоплении".
- Присутствие алкоголя в крови. Он варьировался от аномально высокого до среднего, однако не мог быть объяснён ни количеством выпитого в вечер исчезновения алкоголя, ни стадией разложения тела (при разложении в теле образуется определённое количество алкоголя).
- На основе анализа 1200 случаев в США и Канаде Дэвид Полидес идентифицировал 52 кластера пропавших людей, т.е. в определённых местах (по большому счёту в национальных парках) люди исчезают намного чаще. Несколько из крупнейших кластеров находятся вокруг Великих озёр в США.
 -Натренированные собаки-ищейки вдруг теряли нюх и были не в состоянии взять след пропавших людей. В день исчезновения Элизы Лэм полицейские безрезультатно обыскивали с помощью поисковых собак весь отель, в т.ч. и крышу, где было позже найдено её тело.
- Потеря памяти. Оставшиеся в живых не могли вспомнить детали их исчезновения. Часто их находили в бессознательном или полубессознательном состоянии.
- Потеря чувства времени. В большинстве случаев, изученных Дэвидом Полидесем, жертвы не могли вспомнить, что они делали в определённые промежутки времени.
- Уровень интеллекта жертв. Во многих случаях пропавшими были либо студенты с высоким уровнем интеллекта (и многообещающим будущим), либо студенты-атлеты. В других же случаях пропавшими были, наоборот, либо тяжело (душевно) больные дети/студенты, либо инвалиды. Т.е. в обоих случаях мы имеем дело не со обычными среднестатистическими людьми.
- Множество пропавших в США/Канаде имели либо наследственные немецкие корни (вплоть до многих поколений в прошлом), либо изучали немецкий язык и свободно говорили на нём.
- Большинство тел жертв находили в местах, которые многократно и тщательно прочёсывались десятками поисковиков (часто с собаками-ищейками).
- Потеря одежды и/или обуви. Жертв часто находили без обуви, штанов и т.д. при обстоятельствах, которые не могли объяснить эту потерю. Были также случаи, в которых ремни были необычно закреплены на штанах. Как и почему жертвы теряли свою одежду (часто при неблагоприятных погодных условиях), остаётся загадкой.
- Пропажа в зданиях. Несколько детей пропадали из домов с установленной и исправной сигнализацией, которая никогда не срабатывала в момент исчезновения. Множество молодых людей исчезали в барах с установленными камерами видеонаблюдения: на камерах было видно, как они входили в бар, однако момент их выхода из бара никогда не фиксировался на камеру, несмотря на их исправность и бесперебойную работу. В других случаях вращающиеся камеры видеонаблюдения, направленные на берег рек/водоёмов фиксировали жертву, однако несколько мгновений спустя при очередном повороте камеры жертвы буквально растворялись в воздухе.
- Странные и краткосрочные погодные изменения в месте пропажи. В ночь пропажи часто наблюдались внезапные ливни, штормы или снегопады. Множество исчезновений происходили перед началом страшных ураганов. Это как если бы кто-то пытался помешать поисковым командам искать пропавшего.
- Большинство исчезновений происходили в ночной период: от полуночи до утренней зари.
- Выход из строя мобильных телефонов. Большинство найденных мобильных телефонов были либо разбиты, либо найдены с севшими батареями. В некоторых случаях исчезновение происходило прямо во время телефонного разговора! Жертвы внезапно становились нервозными и говорили о том, что их кто-то преследует. После чего их речь становилась бессвязной и был слышен лишь свист ветра (как будто их кто-то внезапно поднимал в воздух), после чего связь обрывалась.
- Иррациональное поведение. Будучи на вечеринке, молодые люди часто жаловались на внезапное плохое самочувствие или необходимость идти домой пешком, несмотря на расстояния порой в несколько километров и возможность воспользоваться такси/общественным транспортом. Родители/знакомые пропавших студентов также часто сообщали об их странном, ничем не объяснимом поведении в день исчезновения. Вспомните также историю об исчезновении тургруппы Дятлова в 1959 г. на Урале: в тот вечер они не разожгли костёр (и это при минусовых температурах!) и не приготовили ужин, а вместо этого посвятили свой вечер изготовлению стенгазеты.
- Наличие удостоверяющих документов. У пропавших, которых находили в реках и тела которых, находившиеся в воде судя по стадии разложения несколько дней, должны были по идее проплыть по течению несколько километров, практически всегда находили удостоверяющие документы, несмотря на то, что из-за сильного течения у них отсутствовали некоторые части одежды и/или обувь. Как будто кто-то очень хотел, чтобы найденные были быстро опознаны!
- Некоторых пропавших находили вверх по течению от места пропажи, что также противоречило официальной версии об "утоплении".
- В некоторых случаях в телах жертв полностью отсутствовала кровь! Причём следователям никогда не удавалось установить, каким образом кровь была удалена из тела. Ведь для полного удаления крови из тела (если мы имеем дело с маньяком) необходимо специальное оборудование, которое всегда оставляет определённые порезы на теле. Такие порезы/следы от иглы никогда не были обнаружены. Следует также отметить, что Дэвид Полидес расследовал эти случаи как частное лицо (а не как полицейский), поэтому вся информация в его книгах базируется лишь на опубликованных фактах или свидетельствах очевидцев. В то же время некоторые детали судмедэкспертизы часто не публиковались вообще (потому что результаты могли бы шокировать общественность? Или может быть отсутствие крови делало саму судмедэкспертизу невозможной?), что говорит о том, что кровь возможно отсутствовала даже у большего количества найденных жертв. Кстати в теле Элизы Лэм также не было найдено ни капли крови!
- В телах нескольких жертв была найдена гамма-оксимасляная кислота (ГОМК). ГОМК - это природная оксикислота, выполняющая важную роль в центральной нервной системе человека. ГОМК в высокой концентрации может применяться как анестетик и седативное средство (во многих странах она находится вне закона), так как она способна парализовать мышцы человека, не вызывая потерю сознания. Т.е. если жертвам была введена определённая доза ГОМК, после чего они (ещё живые) были помещены в воду, то они (полностью осознавая происходящее) были бы не в состоянии выбраться из воды и в конечном счёте тонули. Полубессознательное состояние и несвязная речь оставшихся в живых жертв также говорят о возможном использовании ГОМК.

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #93 : 24.06.20 21:35 »
Следует также отметить, что Дэвид Полидес расследовал эти случаи как частное лицо (а не как полицейский), поэтому вся информация в его книгах базируется лишь на опубликованных фактах или свидетельствах очевидцев. В то же время некоторые детали судмедэкспертизы часто не публиковались вообще
Если бы с этой фразы начать, то и нечем было бы заканчивать ))))
По сути, она объясняет все якобы нелогичности приведенные выше. Стоит принять тот факт, что результат экспертизы верный, а свидетели и слухи просто искаженные факты и все становится на свои места без всякие потусторонних тварей.

- Множество исчезновений происходили вблизи кустов с ягодами и больших гранитных глыб.
Исчезновения происходили только 3 месяца в году?! Или там ягоды круглый год?!

- Тела пропавших часто находили в воде (в реках, прудах, водоёмах, болотах и даже в пересохших ручьях), поэтому официальное заключение о причине смерти часто звучало как "утопление", несмотря на то, что многие другие факты, говорящие против этого.
А ну да..
Тело в пруду, а легких вода, но местный охотник слышал в лесу непонятный грохот.
Они просто утонули - такое бывает.

- Полное отсутствие свидетелей исчезновения. Пропавшие часто просто растворялись в воздухе в нескольких метрах от своих родителей/друзей, однако никто не видел самого момента исчезновения.
Ну так лес же. И возможно пьянка в лесу.
Тут без всяких посторонних сущностей можно исчезнуть незамеченным.

Например, тела нескольких детей возрастом до 5 лет находили на склоне высоких гор, куда даже опытным альпинистам не было возможно добраться.
А как же их нашли, если добраться никто не мог?!
Орлы Гендальфа заметили и рассказали?!


- - Присутствие алкоголя в крови. Он варьировался от аномально высокого до среднего, однако не мог быть объяснён ни количеством выпитого в вечер исчезновения алкоголя, ни стадией разложения тела (при разложении в теле образуется определённое количество алкоголя).
Данный фактор нельзя рассматривать в куче, а только с указанием четкой личности. Если это 5-летний ребенок, то это одно, а если сантехник дядя Джонни, который трезвым отошел от жены за куст - то тут, возможны варианты без телепортаций )))

Наличие удостоверяющих документов. У пропавших, которых находили в реках и тела которых, находившиеся в воде судя по стадии разложения несколько дней, должны были по идее проплыть по течению несколько километров, практически всегда находили удостоверяющие документы, несмотря на то, что из-за сильного течения у них отсутствовали некоторые части одежды и/или обувь. Как будто кто-то очень хотел, чтобы найденные были быстро опознаны!
Вам прям не угодишь - нет документов, значит тварь их специально сперла, есть документы, значит спецом оставила. )))
Паспорта держат во внутренних карманах, и потеря ботинка и потеря паспорта изнутри - это не одно и тоже.
Ничего удивительного здесь нет.

- Большинство исчезновений происходили в ночной период: от полуночи до утренней зари.
Хм.. Ночью, с вечеринки исчезает молодой студент,  никем не замеченный. И у него оказывается повышенное содержание синьки в крови.

Нет. Такого в нашем мире быть не может - это однозначно тварь из портала.

Будучи на вечеринке, молодые люди часто жаловались на внезапное плохое самочувствие или необходимость идти домой пешком, несмотря на расстояния порой в несколько километров и возможность воспользоваться такси/общественным транспортом.
Эээээ. Это я такой испорченный или вы настолько невинны?!?!?

Да  я таких случаев мильон видел - большинство из обошлось, некоторые закончились дракой, приводами в милицию, разбитыми об асфальт хлеборезками, венерическими заболеваниями. Да - никто не попал в портал - видимо пили не то или не там или не с тем..
Я не знаю, но однозначно загадка.

- Странные и краткосрочные погодные изменения в месте пропажи. В ночь пропажи часто наблюдались внезапные ливни, штормы или снегопады. Множество исчезновений происходили перед началом страшных ураганов. Это как если бы кто-то пытался помешать поисковым командам искать пропавшего.
Нет. Эти погодные явления сбивали с толку потеряшек и те гибли.
Зачем сбивать с толку поисковые команды в этом мире, если жертва провалилась в портал ?!?!?!?
Ну что за бред в самом-то деле.
То студент исчезает в трех шагах от группы - в портал якобы проваливается, то его Супермен на высоту поднимает со страшной скоростью, а то, кто-то боится какой-то там поисковой команды, что аж погоду меняет..

Пусть Дэвид определится чего он найти-то хочет..

- Уровень интеллекта жертв. Во многих случаях пропавшими были либо студенты с высоким уровнем интеллекта (и многообещающим будущим), либо студенты-атлеты. В других же случаях пропавшими были, наоборот, либо тяжело (душевно) больные дети/студенты, либо инвалиды. Т.е. в обоих случаях мы имеем дело не со обычными среднестатистическими людьми.
Многие случаи это не все.
А поскольку здесь опрашивались свидетели. то высокий уровень интеллекта и спортивности может быть неким посмертным преувеличением..
Такие панегирики можно прочитать про каждого умершего.
Автор просто подгоняет слухи под теорию..

Остальное комментировать лень. Но смысл понятен - энтузиаст-любитель собирает слухи и подпирает ими свою теорию. Пр всем моем уважении к его труду - никаких намеков на порталы, тварей и прочее я не вижу..

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #94 : 25.06.20 17:17 »
Исчезновения происходили только 3 месяца в году?! Или там ягоды круглый год?!
Естественно, зимой мало кто там будет бродить. Но зимние исчезновения также имелись, хотя % посещений был минимальным.
Цитирование
Ну так лес же. И возможно пьянка в лесу.
Тут без всяких посторонних сущностей можно исчезнуть незамеченным.
Можно, но не стоит считать, что все случаи происходили по такому странному сценарию: сидел человек,  отошел на минуту и пропал навсегда. Неизвестно зачем пошел к расщелине, провалился тут же, а недели поисков ничего не дают.
Цитирование
Зачем сбивать с толку поисковые команды в этом мире, если жертва провалилась в портал ?!?!?!?
Нет однозначного мнения о портале. Большинство считает, что нет никаких порталов, однако, понятие есть и некоторые в это верят. Задача - не пытаться объяснить ситуацию пропажи стараясь привязать обязательно к знакомой "естественной" причине или неадекватному состоянию пропавшего. Изначально надо ставить вопрос так:
человек был полностью вменяем, внешние погодные условия были благоприятными, порталов и аномалий не было. КАКАЯ МОГЛА БЫТЬ ПРИЧИНА ИСЧЕЗНОВЕНИЯ, если принять все возможные известные данные от свидетелей происшествия?
Камень, который отвергли строители, сделался главою угла.

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #95 : 25.06.20 17:37 »
человек был полностью вменяем
Здесь важно не делать допущений, которые могут оказаться ошибочными.

Кинулся бежать в страхе и исчез: странное исчезновение в лесу Айдахо в 2018 году

В тот день Вудс вел себя немного тише, чем обычно, но все члены группы сильно устали, поэтому поведение режиссера не выделялось чем-то особенным. Но когда люди стали собирать инструменты, чтобы покинуть район шахты, все увидели нечто странное:

Они увидели, как Вудс бежит на всей скорости по направлению к лесу и не было видно ни одной причины, которая заставила бы его сделать это. Он так же не кричал, а просто быстро бежал в лес.

"Мы заканчивали дневную работу и Вудс разговаривал с одним их местных шахтеров. Я сидел в машине, когда Вудс вдруг сказал, что ему надо отойти и успокоиться. Он в этот момент стоял на скале, а когда я через пару мгновений снова взглянул на скалу, то заметил лишь, что на земле у подножия скалы лежит рация Вудса.

Сначала я подумал, что Вудс тоже упал со скалы, я выскочил из машины и побежал туда, но когда я добежал до скалы, то заметил Вудса, который находился от скалы на расстоянии 15 футов (5 метров) и с каждым мгновением он удалялся все дальше, быстро убегая вниз к деревьям, как заяц.

Я никогда в жизни не видел, чтобы человек так быстро бегал. Я закричал членам команды, чтобы они садились в машины и выезжали на главную дорогу, а сам решил нагнать Вудса. При этом я не стал бежать за ним, я шел пешком, я решил, что увидев меня бегущим, он еще больше перепугается и ускорит бег.

Вскоре я потерял Вудса из виду, а потому вернулся к скале. Я связался с командой и узнал, что они не встретили Вудса и на главной дороге. Сотовая связь тут работала с перебоями, поэтому нам пришлось искать дом со стационарным телефоном, чтобы позвонить в полицию и сообщить о пропаже нашего режиссера", – рассказывал руководитель съемочной группы.

Grimm


  • Сообщений: 641
  • Благодарностей: 139

  • Расположение: SPB

  • Был вчера в 17:53

Missing 411
« Ответ #96 : 25.06.20 18:23 »
Здесь важно не делать допущений, которые могут оказаться ошибочными.
Зачем вы все это пишете? По моему, вы ничего не обсуждаете. У вас нет вопросов, критического взгляда на свои (если они свои) мысли...
Обсуждение предполагает рассмотрение разных гипотез произошедшего. Возможно даже, доказательство от обратного.. У вас нет ничего подобного. Отсюда вопрос - что вы здесь делаете? Какова ваша цель?

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #97 : 25.06.20 18:35 »
Зачем вы все это пишете?
Чтобы снабдить вас ценной информацией.

Конечно, если вы считаете бегство человека в лес нормальным поведением, то мне лучше ничего не писать.

Цитирование
По моему, вы ничего не обсуждаете. У вас нет вопросов, критического взгляда на свои (если они свои) мысли...
А смысл? Я расписал схему, по которой пропадают люди. Если вы подозреваете меня в плагиате, извольте предоставить доказательства.

Цитирование
Обсуждение предполагает рассмотрение разных гипотез произошедшего. Возможно даже, доказательство от обратного.. У вас нет ничего подобного.
К сожалению, я немножко занят, чтобы расписать свою позицию подробнее. Там будет место самокритике.

Цитирование
Отсюда вопрос - что вы здесь делаете? Какова ваша цель?
Активно участвую в жизни вашего форума, вношу полезный вклад. ;)
« Последнее редактирование: 25.06.20 18:44 »

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #98 : 25.06.20 18:41 »
Здесь важно не делать допущений, которые могут оказаться ошибочными.

Кинулся бежать в страхе и исчез: странное исчезновение в лесу Айдахо в 2018 году

В тот день Вудс вел себя немного тише, чем обычно, но все члены группы сильно устали, поэтому поведение режиссера не выделялось чем-то особенным. Но когда люди стали собирать инструменты, чтобы покинуть район шахты, все увидели нечто странное:

Они увидели, как Вудс бежит на всей скорости по направлению к лесу и не было видно ни одной причины, которая заставила бы его сделать это. Он так же не кричал, а просто быстро бежал в лес.

"Мы заканчивали дневную работу и Вудс разговаривал с одним их местных шахтеров. Я сидел в машине, когда Вудс вдруг сказал, что ему надо отойти и успокоиться. Он в этот момент стоял на скале, а когда я через пару мгновений снова взглянул на скалу, то заметил лишь, что на земле у подножия скалы лежит рация Вудса.

Сначала я подумал, что Вудс тоже упал со скалы, я выскочил из машины и побежал туда, но когда я добежал до скалы, то заметил Вудса, который находился от скалы на расстоянии 15 футов (5 метров) и с каждым мгновением он удалялся все дальше, быстро убегая вниз к деревьям, как заяц.

Я никогда в жизни не видел, чтобы человек так быстро бегал. Я закричал членам команды, чтобы они садились в машины и выезжали на главную дорогу, а сам решил нагнать Вудса. При этом я не стал бежать за ним, я шел пешком, я решил, что увидев меня бегущим, он еще больше перепугается и ускорит бег.

Вскоре я потерял Вудса из виду, а потому вернулся к скале. Я связался с командой и узнал, что они не встретили Вудса и на главной дороге. Сотовая связь тут работала с перебоями, поэтому нам пришлось искать дом со стационарным телефоном, чтобы позвонить в полицию и сообщить о пропаже нашего режиссера", – рассказывал руководитель съемочной группы.
важно еще - нашли ли его в итоге и в каком виде
Камень, который отвергли строители, сделался главою угла.

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #99 : 26.06.20 00:04 »
Естественно, зимой мало кто там будет бродить. Но зимние исчезновения также имелись, хотя % посещений был минимальным.
Я дико извиняюсь, Сергей, но вы опять рассматриваете эту версию со своей, всем известной колокольни.
И вот если это не СЧ, то как завязаны похищения и зима?!

Можно, но не стоит считать, что все случаи происходили по такому странному сценарию: сидел человек,  отошел на минуту и пропал навсегда. Неизвестно зачем пошел к расщелине, провалился тут же, а недели поисков ничего не дают.
Сидел человек, отошел в туалет, заблудился и пропал навсегда.
Особенно если пьяным был.
И все остальные под градусом, так что минута здесь понятие растяжимое до часа...

Нет однозначного мнения о портале.
Хотелось бы это от Мартина услышать ))))
Да и главный исследователь этого безобразия уверен как раз в портале..

человек был полностью вменяем, внешние погодные условия были благоприятными, порталов и аномалий не было. КАКАЯ МОГЛА БЫТЬ ПРИЧИНА ИСЧЕЗНОВЕНИЯ, если принять все возможные известные данные от свидетелей происшествия?
Ну с ходу:
1.Маньяк
2.Несчастный случай
3. Убийство как раз теми самыми свидетелями..
4...

Я никогда в жизни не видел, чтобы человек так быстро бегал. Я закричал членам команды, чтобы они садились в машины и выезжали на главную дорогу, а сам решил нагнать Вудса.
Вот!!
Это показания ОДНОГО свидетеля из целой команды. Остальные этого не видели.
Так что резонный вопрос - а был ли этот немотивированный бег вообще?!

важно еще - нашли ли его в итоге и в каком виде
Ну, судя по совершенно разному состоянию трупов - это-то как раз не важно..
Все равно под единую версию не причешешь.

То ли утонул, то ли пьян, то ли стоя во льду, то ли где-то в горах на вершине пустой..
Что это доказывает?!
Только одно - в некоторых случаях это был явно не СЧ.
То есть его в разных бяках подозревают, но чтоб перед смертью жертву ханкой поить, такого за ним  точно не водится.
))))

Добавлено позже:
В тот день Вудс вел себя немного тише, чем обычно, но все члены группы сильно устали, поэтому поведение режиссера не выделялось чем-то особенным.
Вот еще вопрос о вменяемости. Вроде как все устали, вроде как ничего необычного, но его странное поведение с самого утра запомнилось.
Это значит с утра оно отличилось от обычного.
Никакого мгновенного гипноза не было - перед пропажей был человек в уже измененном состоянии.
« Последнее редактирование: 26.06.20 00:08 »

Grimm


  • Сообщений: 641
  • Благодарностей: 139

  • Расположение: SPB

  • Был вчера в 17:53

Missing 411
« Ответ #100 : 26.06.20 06:24 »
Чтобы снабдить вас ценной информацией.
Хорошо, давайте говорить откровенно. Позвольте мне решать, какая информация мне нужна и какова ее ценность. Во-вторых, тема предполагает обсуждение (на равных), а не то, что кто-то, считающий себя в праве решать, что для меня "ценно", будет меня чем-то снабжать.
И дело не в плагиате. Я не вижу у вас критического отношения к тому материалу, которым вы "снабжаете" форум и к тем выводам, которые вы из него делаете. Такой подход снижает ценность вашей информации и выводов до нуля.
И по вашему что? Здесь стадо собралось, которому не доказывая и не выражая сомнений в своих действиях можно скормить что угодно? Мне совершенно непонятна роль учителя или "пастыря", которую вы на себя взяли. Еще раз - тема создана для обсуждения, а не для вашей проповеди и вы не можете этого не понимать (или можете?). Тогда зачем вы здесь если для вас и так все понятно?

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #101 : 26.06.20 07:18 »
Позвольте мне решать, какая информация мне нужна и какова ее ценность.
Никто не забирает у вас этого права.

Цитирование
Во-вторых, тема предполагает обсуждение (на равных), а не то, что кто-то, считающий себя в праве решать, что для меня "ценно", будет меня чем-то снабжать.
Я обсуждаю с Дроздовым "на равных". Вы тоже можете присоединиться :)

Цитирование
Я не вижу у вас критического отношения к тому материалу, которым вы "снабжаете" форум и к тем выводам, которые вы из него делаете. Такой подход снижает ценность вашей информации и выводов до нуля.
Информация собрана не мной, я всего лишь скопипастил ее сюда.

Цитирование
И по вашему что? Здесь стадо собралось, которому не доказывая и не выражая сомнений в своих действиях можно скормить что угодно?
Не верите мне? Так загуглите.

Цитирование
Мне совершенно непонятна роль учителя или "пастыря", которую вы на себя взяли.
Совершенно поразительный  вывод. В любом случае, меняться в угоду вам я не намерен.

Цитирование
Еще раз - тема создана для обсуждения, а не для вашей проповеди и вы не можете этого не понимать (или можете?).
Ну так и обсуждайте. Вон, Дроздову ничего не мешает обсуждать. :)

Цитирование
Тогда зачем вы здесь если для вас и так все понятно?
Мне понятен общий принцип, но хотелось бы разобраться в частностях.

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #102 : 30.06.20 11:00 »
От нечего делать немного продолжу дискуссию :

- Некоторых пропавших находили вверх по течению от места пропажи, что также противоречило официальной версии об "утоплении".
Чегой-то?!
Человек заблудился возле реки, блукал по лесу, наконец-то через какое-то время еще раз наталкивается на эту же речку а поскольку дезориентирован, то принимает решение идти вверх по течению.
Он устал, темно - падает с обрыва и тонет. И запутывается в ветках ВЫШЕ по течению, чем то место, где его видели последний раз. Или решил реку переплыть выше по течению и утонул.

- Выход из строя мобильных телефонов. Большинство найденных мобильных телефонов были либо разбиты, либо найдены с севшими батареями. В некоторых случаях исчезновение происходило прямо во время телефонного разговора! Жертвы внезапно становились нервозными и говорили о том, что их кто-то преследует.
Ну... Их преследовал маньяк и разбил телефон. Чего странного-то?!
А севшая батарея.. Ну вот у меня вокруг куча народу бродит, которые свои телефоны по разу на дню заряжают. Ибо садятся очень быстро.

Несколько детей пропадали из домов с установленной и исправной сигнализацией, которая никогда не срабатывала в момент исчезновения. Множество молодых людей исчезали в барах с установленными камерами видеонаблюдения: на камерах было видно, как они входили в бар, однако момент их выхода из бара никогда не фиксировался на камеру, несмотря на их исправность и бесперебойную работу.
Вообще-то, сигнализация не панацея от похищения.
Ломают их разными способами.

- На основе анализа 1200 случаев в США и Канаде Дэвид Полидес идентифицировал 52 кластера пропавших людей, т.е. в определённых местах (по большому счёту в национальных парках) люди исчезают намного чаще. Несколько из крупнейших кластеров находятся вокруг Великих озёр в США.
Ну да. Все верно.
В огромных лесных массивах со сложными природными условиями люди пропадают чаще, чем в городских аллеях.
Согласен.
Внимание вопрос - а чего здесь необычного-то?!

- Множество пропавших в США/Канаде имели либо наследственные немецкие корни (вплоть до многих поколений в прошлом), либо изучали немецкий язык и свободно говорили на нём.
Грехи отцов - факт.
Не любит Господь немцев и есть за что..

А если серьезно, то вот если бы в Сибири пропадали только потомки португальцев, то я бы удивился.
А то, что в местах, где полно потомков немцев пропадают потомки немцев - это уже натяжка.
Рупь за сто, если бы пробить их английские корни, то они найдутся у большинства пропавших. И французские. И ирландские.
или знание этих языков.
Это как бы Америка.

Искомое существо не имеет логова в нашем мире, иначе его бы давным-давно нашли.
Я вот о чем подумал, Мартин, а что если эта тварь - снежный человек, а?!
Вот как удобненько было бы  - все вопросы враз решаются.

Он же человек, хоть и снежный, так что право жрать кого поймает ему дано от рождения. или в специальной книге прописано - что он создан по образу и подобию, а остальные нет.
Где живет снежный человек и что ест - да в параллельном мире прячется и трескает тех, кто к нему провалился. Оттого его в нашем никто поймать не может.
И следов найти.

И с мотивацией всё понятно - хоть и еда сама из порталов к нему проваливается у него же все равно баба есть. Снежная, естесно. И эта баба, когда беременная сидит, начинает ныть, грысть мозг мужу и давить на психику - немцы надоели, от этих капустников меня пучит постоянно, студиозы вечно пьяные, обкуренные  и под наркотой - о ребенке нашем подумай!!!, кто-то ягод наестся и к нам проваливается, а у меня на малину аллергия.. Иди-ка ты, муженек снежный, идол равнодушный и найди мне негра блондинистого, в валенках да чтоб иврит знал и вязать умел крючком. В последнем выпуске снежного журнала прописано, что именно такие беременным полезны.

Вот и бегают мужики-йети к нам в мир и хулиганят и беспределят в поисках заказанного, а потом прыг в портал и нет его. Никакая собака след не возьмет.

Вот и все нестыковки состыкованны )))

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #103 : 30.06.20 17:15 »
- Некоторых пропавших находили вверх по течению от места пропажи, что также противоречило официальной версии об "утоплении".
Человек заблудился возле реки, блукал по лесу, наконец-то через какое-то время еще раз наталкивается на эту же речку а поскольку дезориентирован, то принимает решение идти вверх по течению.
Это противоречит версии об утоплении. Утопленники плавать не умеют.

Решение идти вверх по течению примет только очень глупый человек. Умные люди идут к устью, а не к истоку.

Цитирование
"Выход из строя мобильных телефонов. Большинство найденных мобильных телефонов были либо разбиты, либо найдены с севшими батареями. Ну... Их преследовал маньяк и разбил телефон. Чего странного-то?!"
Во-первых, маньяку телефон до лампочки. Он его скорее выключит, если будет опасаться трекинга. Во-вторых, в режиме ожидания телефон может прожить довольно долго, поэтому непонятно, что именно высадило батарею. (Аномальные зоны, кстати, высаживают аккумуляторы в ноль.)

Полагаю, телефоны использовались жертвами как оружие, чтобы отбиться. Вероятно, у твари прочный панцирь.

Цитирование
Несколько детей пропадали из домов с установленной и исправной сигнализацией, которая никогда не срабатывала в момент исчезновения. Множество молодых людей исчезали в барах с установленными камерами видеонаблюдения: на камерах было видно, как они входили в бар, однако момент их выхода из бара никогда не фиксировался на камеру, несмотря на их исправность и бесперебойную работу.
Скорее всего, в базу Паулидеса попали ординарные случаи перехода в параллельный мир. Это может произойти и дома, в спокойной обстановке.

Цитирование
В огромных лесных массивах со сложными природными условиями люди пропадают чаще, чем в городских аллеях.
Согласен. Внимание вопрос - а чего здесь необычного-то?!
Кластеризация всех пропаж вокруг озер. Если посмотреть на карту, то точечки вокруг озер будут густо-густо.

Объяснений пока нет.

Цитирование
- Множество пропавших в США/Канаде имели либо наследственные немецкие корни (вплоть до многих поколений в прошлом), либо изучали немецкий язык и свободно говорили на нём.
И это тоже необъяснимо. Возможно, случайное совпадение, а может, вместе с немецкими корнями через гены подтягивается какой-нибудь специфичный запах тела.

Добавлено позже:
Я вот о чем подумал, Мартин, а что если эта тварь - снежный человек, а?!
Дроздов, здесь можно гадать сколько угодно, но четкого ответа пока нет.

Пока можно утверждать лишь то, что она любит воду и имеет панцирь. По крайней мере, какую-то твердую защиту тела, о которую можно разбить мобильник.
« Последнее редактирование: 30.06.20 17:19 »

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #104 : 30.06.20 18:11 »
Это противоречит версии об утоплении. Утопленники плавать не умеют.

Решение идти вверх по течению примет только очень глупый человек. Умные люди идут к устью, а не к истоку.
Вообще-то умеют. Я регулярно сталкиваюсь с фактом, что человек утонувший в Северо-Западном округе Москвы доплывает до Центрального, а то и Южного.
Шучу.

Вы не поняли - он доходит по берегу в темноте и уставшим до какой-то точки и видит на другом берегу огоньки. Хочет переплыть, но тонет.
Или падает в овраг-промоину и тонет.
Про умных людей посмешило ))))
Он дезориентирован

. И думает. что находится ниже по течению, чем лагерь/город/пост лесной охраны.
Потому и идет вверх по течению. Или просто не умный.

Во-первых, маньяку телефон до лампочки. Он его скорее выключит, если будет опасаться трекинга. Во-вторых, в режиме ожидания телефон может прожить довольно долго, поэтому непонятно, что именно высадило батарею. (Аномальные зоны, кстати, высаживают аккумуляторы в ноль.)

Полагаю, телефоны использовались жертвами как оружие, чтобы отбиться. Вероятно, у твари прочный панцирь.
Во-первых нет. Телефон  - это средство связи и поиска и разбить его вполне себе здравое решение маньяка.
Чем по запарке искать кнопку отключения и убеждаться в том, что он действительно выключен.
Проще со всей дури об камень.
Это широкие лесные и горные массивы, значит прием хуже. Энергии тратится больше, и аккумулятор быстрее садится. Они же не со 100% все были перед пропажей после целого дня туризма.

Про крепкий панцирь это очень смелое предположение. Может это вообще Терминатор был?! Об него телефоны ломать вообще одно удовольствие..

Скорее всего, в базу Паулидеса попали ординарные случаи перехода в параллельный мир. Это может произойти и дома, в спокойной обстановке.
Скажем так - попали случаи, которые он расценивает как переход в параллельный мир.
Только вот видимо с кухни они шагнули туда - на кухне и ягоды и вода и гранитная столешница..

Кластеризация всех пропаж вокруг озер. Если посмотреть на карту, то точечки вокруг озер будут густо-густо.

Объяснений пока нет.
Да как бы есть.. И не одно и без порталов. Но так хочется параллельных миров!!

И это тоже необъяснимо. Возможно, случайное совпадение, а может, вместе с немецкими корнями через гены подтягивается какой-нибудь специфичный запах тела.
Вот зачем вы так со мной, Мартин?!?!
Я примерно десять шуток перебрал и отверг про запахи разных народов..
Так хочется их вставить - но забанят ...

Ладно вставлю 11-тую.. Когда наши предки говорили - "Немец-перец -колбаса, кислая капуста" они явно что-то знали.. Что это как не описание генетически присущего им запаха?!?

Пока можно утверждать лишь то, что она любит воду и имеет панцирь. По крайней мере, какую-то твердую защиту тела, о которую можно разбить мобильник.
А пропажи в горах?! А живет-то она где - в портале или в озере?! А как же гранитные глыбы и ягоды?!

И вообще - некоторые студенты пропадали прям вот рядышком со своей компанией. За кустик отошли и привет.  А теперь можно утверждать оказывается, что рядышком с ними пряталась какая-то тварь в панцире, да еще с которой драться можно?! То есть не сразу отрубает жертву, а медленно утаскивает.  Ее-то как не заметили?!

Да и вообще. Вот вы мужчина. Проведите эксперимент - возьмите в руку ненужный старый телефон и долбите им по твердой поверхности, типа отбиваетесь от панцирной твари. С одного раза его не разбить - надо сильно колотить и не раз. Он сжат в руке, проскальзывает от пота, замаха может и не быть..
Значит бой с тварью вообще мог быть долгим?!?!

Нее... Думаю, что рано какие-то подобные утверждения делать на пустом месте..

Хотя с другой стороны по уверенным утверждения можно уверенно утверждать, что это был крокодил))) Все приметы сходятся..
« Последнее редактирование: 30.06.20 19:45 »

arfaxad


  • Сообщений: 889
  • Благодарностей: 714

  • Расположение: Кубань

  • На форуме

Missing 411
« Ответ #105 : 30.06.20 19:51 »
David Paulides  вероятно не случайно присвоил серии своих книг код компьютерной ошибки 411,
411 Length Required («необходима длина»), другими словами в его названии Missing - недостающий,
Length Required - требуемая длина, из сотен номеров разных кодов ошибок http он выбрал для своего
названия именно 411, - это совпадение или случайность, или он знает больше того чем пишет, ошибка
протокола http ассоциируются у него во всех более чем 1500 случаев пропаж и именно под кодом 411,
но в названии могли же быть и другие коды ошибок
404 Not Found («не найдено»)
408 Request Timeout («истекло время ожидания»)
409 Conflict («конфликт»)
410 Gone («удалён»)
411 Length Required («необходима длина»)  { у него именно эта ошибка протокола 411 }
412 Precondition Failed («условие ложно»)
416 Range Not Satisfiable («диапазон не достижим»)
417 Expectation Failed («ожидание не удалось»)
422 Unprocessable Entity («необрабатываемый экземпляр»)
423 Locked («заблокировано»)
424 Failed Dependency («невыполненная зависимость»)
426 Upgrade Required («необходимо обновление»)
503 Service Unavailable («сервис недоступен»)
504 Gateway Timeout («шлюз не отвечает»)
520 Unknown Error («неизвестная ошибка»)
522 Connection Timed Out («соединение не отвечает»)
523 Origin Is Unreachable («источник недоступен»)
524 A Timeout Occurred («время ожидания истекло»)
как видим есть ещё куда расти, есть огромный диапазон для новых названий новых серий его книг исследований.
но почему же у  David Paulides выбран код ошибки по пропажам именно 411 ?
411 Length Required — "для указанного ресурса клиент должен указать Content-Length в заголовке запроса,
без указания этого поля не стоит делать повторную попытку запроса к серверу по данному адресу ориентиру,
разумней будет проверить в самом начале заголовок Content-Length и сразу отказать в загрузке,
чем провоцировать бессмысленную нагрузку, разрывая соединение, когда клиент действительно пришлёт
вам в обратный ответ весомое сообщение", вот возможно в этой расшифровке и весь смысл названия 411
а подробней наверное знает только сам  David Paulides  )
иногда счастье — это когда ничего не происходит

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #106 : 30.06.20 19:55 »
из сотен номеров разных кодов ошибок http он выбрал для своего
названия именно 411, - это совпадение или случайность,
Ни то, ни другое.

Номер "4-1-1" когда-то был закреплен в США за региональной информационной службой.

Добавлено позже:
Во-первых нет. Телефон  - это средство связи и поиска и разбить его вполне себе здравое решение маньяка.
Чем по запарке искать кнопку отключения и убеждаться в том, что он действительно выключен.
Проще со всей дури об камень.
И оставить рядом с жертвой? :)

Рациональный маньяк аккуратно отключит телефон кнопкой питания, сотрет с него все отпечатки и загонит в землю ударом ноги. Просто ударить о камень - этого мало, это ненадежно.
« Последнее редактирование: 30.06.20 20:19 »

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #107 : 01.07.20 08:20 »
И оставить рядом с жертвой? 

Рациональный маньяк аккуратно отключит телефон кнопкой питания, сотрет с него все отпечатки и загонит в землю ударом ноги. Просто ударить о камень - этого мало, это ненадежно.
С какой еще жертвой?! Это же пропажа.

Такие рациональные маньяки только в голливудских фильмах встречаются. А со всей дури телефон о выступ скалы - это средство верное.
« Последнее редактирование: 01.07.20 08:20 »

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #108 : 01.07.20 10:07 »
Такие рациональные маньяки только в голливудских фильмах встречаются.
Вы зря путаете маньяка и психически больного человека с волевым дефектом.

А со всей дури телефон о выступ скалы - это средство верное.
Ага, и оставить рядом с жертвой.

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #109 : 01.07.20 10:41 »
Вы зря путаете маньяка и психически больного человека с волевым дефектом.
Да Бога ради. Пусть будет волевой маньяк.  )))
Я не против.
Лишь бы не крокодил из параллельной Вселенной.

Ага, и оставить рядом с жертвой.
Жертва пропала. Или найдена далеко.
Впрочем ладно..

Со всем остальными моими замечаниями вы видимо согласны.
Я рад. )))

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #110 : 01.07.20 13:29 »
Со всем остальными моими замечаниями вы видимо согласны.
Пожалуйста, не делайте никаких умозаключений обо мне.

Это не только невежливо, но еще и офтопик.

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #111 : 01.07.20 16:33 »
Пожалуйста, не делайте никаких умозаключений обо мне.

Это не только невежливо, но еще и офтопик.
Это затравка на опровержение моих слов и выкладывание новой информации о пропажах )))
А то дискуссия зачахла ))

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #112 : 02.07.20 11:05 »
Да как бы есть.. И не одно и без порталов. Но так хочется параллельных миров!!
Ситуации типа "зашел в бар и не вышел, хотя кругом камеры" - классический пример перехода в параллельный мир.

Полиция наверняка там всё обшарила, всех допросила с пристастием. И если человеческий фактор исключен, остается только одно объяснение.

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #113 : 02.07.20 13:55 »
Ситуации типа "зашел в бар и не вышел, хотя кругом камеры" - классический пример перехода в параллельный мир.

Полиция наверняка там всё обшарила, всех допросила с пристастием. И если человеческий фактор исключен, остается только одно объяснение.
Это классический пример убийства в баре. И сокрытия трупа.. А потом вынос по частям.
Или отключение камер.
Или, завсегдай/работник/хозяин бара, провел его по мертвым зонам камер - что вероятнее всего.

Типа опрос свидетелей всегда дает стопроцентную правду. Кто не видел, кто соврал.

Про переход в параллельный мир из бара вообще много вопросов. Где вода в больших количествах? Ягоды, гранит?!!
Почему посетители не увидели чудище бронированное?!
Почему все мобильники в баре у всех скопом не разрядились?!

 

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #114 : 02.07.20 14:58 »
Это классический пример убийства в баре. И сокрытия трупа.. А потом вынос по частям.
Или отключение камер.
Слишком много возни ради случайного посетителя. Проще дождаться, когда он сходит до ближайших кустов, и там огреть бейсбольной битой.

Добавлено позже:
Про переход в параллельный мир из бара вообще много вопросов.
Тут как раз вопросов нет вообще. Достаточно на мгновение уединиться... и всё, вы уже не здесь.

Добавлено позже:
Вообще, я выделяю три гипотезы о причинах исчезновений:

1. Природная.

Любые естественные причины пропаж, начиная от карстовых провалов и утоплений, заканчивая дикими зверьми, осами и термитами.

2. Человеческая.

Действия злоумышленников, от маньяков-одиночек до скоординированных групп и спецслужб.

3. Сверхъестественная.

Воздействие злой силы неопределенной природы, обладающей могущественными возможностями. От бигфутов и СЧ до инопланетян и тварей с личным квантовым карманом, развитой суггестией и прочным панцирем.

Если проанализировать все выявленные факты относительно этих трех гипотез, внезапно выяснится, что первые две не вполне ложатся в наблюдаемую картину. Например, зверю недосуг тащить на себе сто кило мяса (где поймал, там и сожрал), маньяк обязательно спрячет телефон, а злоумышленники имеют сто и один способ избавиться от тела навсегда.
« Последнее редактирование: 02.07.20 15:03 »

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #115 : 02.07.20 15:06 »
Слишком много возни ради случайного посетителя. Проще дождаться, когда он сходит до ближайших кустов, и там огреть бейсбольной битой.
Кто сказал, что он случайный?!
Это могло быть запланировано на конкретную жертву.
Пока мы знаем только то, что кто-то вошел в бар - по камерам, а момент выхода камеры не зафиксировали.

Тут как раз вопросов нет вообще. Достаточно на мгновение уединиться... и всё, вы уже не здесь.
О как!!
Тоесть люди, которые писают не закрывая двери туалетов боятся провалится в другой мир?!
Хорошо...
А я о них очень плохо думал..

Добавлено позже:
Если проанализировать все выявленные факты относительно этих трех гипотез, внезапно выяснится, что первые две не вполне ложатся в наблюдаемую картину. Например, зверю недосуг тащить на себе сто кило мяса (где поймал, там и сожрал), маньяк обязательно спрячет телефон, а злоумышленники имеют сто и один способ избавиться от тела навсегда.
Совершенно и вполне ложатся..
Действия маньяка нельзя судить с такой определенностью.
КУ злоумышленников есть сто и один мотив не избавляться от тела. Или 100 и 1 причина, по которой не смогли..
« Последнее редактирование: 02.07.20 15:09 »

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #116 : 02.07.20 15:23 »
Кто сказал, что он случайный?!
Это могло быть запланировано на конкретную жертву.
Пока мы знаем только то, что кто-то вошел в бар - по камерам, а момент выхода камеры не зафиксировали.
Американская полиция - не чета нашей. Если б они установили, что записи подчищены, то виновники были тут же изобличены.

И потом, зачем столько возни из-за случайных посетителей? Они ж не миллионы в карманах таскают.

Цитирование
Тоесть люди, которые писают не закрывая двери туалетов боятся провалится в другой мир?!
Большинство и не провалятся никогда. Кое-что должно совпасть.

Лучше гляньте статистику по исчезновениям.

Цитирование
Действия маньяка нельзя судить с такой определенностью.
Маньяк - все-таки человек, и логика у него человеческая.

Цитирование
У злоумышленников есть сто и один мотив не избавляться от тела. Или 100 и 1 причина, по которой не смогли..
Что значит "не смогли"? Бесшумно выкрасть человека - смогли, а расчленить и прикопать позабыли?

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #117 : 02.07.20 15:36 »
Американская полиция - не чета нашей. Если б они установили, что записи подчищены, то виновники были тут же изобличены.

И потом, зачем столько возни из-за случайных посетителей? Они ж не миллионы в карманах таскают.
Точно.
Я тоже эти фильмы смотрел..
Сразу изобличат злодеев...
Жесткий аргумент ))))

И потом, зачем столько возни из-за случайных посетителей? Они ж не миллионы в карманах таскают.
А портал наводить это не возня?!
Почему случайные?! Могли быть и миллионы. Это-то как раз за кадром осталось.

Лучше гляньте статистику по исчезновениям.
И что она докажет ?!
Что есть порталы?! )))

Маньяк - все-таки человек, и логика у него человеческая.
Нет такого понятия человеческая логика.
Вот мы вроде как не маньяки, ну в себе точно уверен, а логика относительно телефона разная..

А разбить или отключить телефон это вообще не логика, а действия сообразные моменту.

Что значит "не смогли"? Бесшумно выкрасть человека - смогли, а расчленить и прикопать позабыли?
Хотели чтобы нашли...
Не хотели чтоб нашли, но просчитались
Решили имитироваться несчастный случай
Решили имитироваться действия маньяка..

Да мало ли...

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #118 : 02.07.20 22:36 »
Точно.
Я тоже эти фильмы смотрел..
Сразу изобличат злодеев...
Изобличить несложно: если записи потерты или подделаны, экспертиза это легко установит. Круг лиц, имевших к ним доступ, известен.

Цитирование
А портал наводить это не возня?!
Если это врожденное умение, то нет. И там не полноценный портал, а кое-что попроще.

Цитирование
Почему случайные?! Могли быть и миллионы. Это-то как раз за кадром осталось.
Откуда у случайного посетителя бара миллионы? о_О

Цитирование
И что она докажет ?!
Что есть порталы?! )))
Из всех случаев бесследных исчезновений 50% приходится на социально уязвимых людей: бомжи, маргиналы, наркоманы, преступники. С ними всё понятно.

А вот остальные 50% - простые люди, как вы и я. Им-то исчезать вовсе не с руки. Они даже не бывают там, где можно исчезнуть. Конечно, сюда можно притянуть маньяков, несчастные случаи и действия злоумышленников, но фактура уж больно густая.
 

Цитирование
Нет такого понятия человеческая логика.
Вот мы вроде как не маньяки, ну в себе точно уверен, а логика относительно телефона разная..
Даже самый отбитый маньяк постарается спрятать телефон. Вдруг микросхема памяти уцелела, а там его фото?

В лесу и прятать особо не надо: разбил аппарат, нашел место с землей помягче, вертикально поставил и одним ударом загнал в землю.

Цитирование
Хотели чтобы нашли...
Не хотели чтоб нашли, но просчитались
Решили имитироваться несчастный случай
Решили имитироваться действия маньяка..
А смысл-то какой?

С какой бы целью ни действовала спецгруппа, она захочет оставлять минимум следов. Маньяк - тоже, эти вообще расчленять любят. Людям не с руки оставлять улики.
« Последнее редактирование: 02.07.20 22:37 »

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #119 : 03.07.20 08:21 »
Изобличить несложно: если записи потерты или подделаны, экспертиза это легко установит. Круг лиц, имевших к ним доступ, известен.
Во-первых сложно, если камеры просто отключались..
Во-вторых, это бар, а не Пентагон, так что круг лиц может быть весь обширным - где там серверная?! В подсобке запертая на задвижку?!
В-третьих, про мертвые зоны я уже говорил?! Вот по ним и вывели или вынесли.

Если это врожденное умение, то нет. И там не полноценный портал, а кое-что попроще.
Врожденное умение, портал для бедных...
Мож всё=таки инопланетяне?!
Там вообще ничего объяснять не надо - чуждый разум, чуждые знания.
Взяли и забрали жертву..

Откуда у случайного посетителя бара миллионы? о_О
Объясняю в 411-ый раз.
Тот самый Джон Смит зашедший в бар был давно у кого-то на примете. Потому что миллионер. Или наследник. Или любовник жены. Или неверный муж. Или сверлящий по ночам сосед..
Охотники знали, что он зайдет в этот бар и там сделали ловушку. И привет, Джонни.
Это не случайность, а вполне себе спланированные действия по имитации исчезновения.

.
Они даже не бывают там, где можно исчезнуть.
Здрасте - ешьте сласти..
А походами по национальным паркам кто занимался?! Бомжи из под моста?!

Вы же на пару с Дэвидом тут поете, что исчезновения в больших лесных массивах происходят. Рядом с ягодами и озерами.
Лес. озеро, горы, ущелья, пересеченная местность.
Это как бы и есть места где можно прекрасно исчезнуть.
Что данные  казуалы и подтвердили.

Даже самый отбитый маньяк постарается спрятать телефон. Вдруг микросхема памяти уцелела, а там его фото?
Если почитать, только на этом форуме про маньяков, то легко установить, что многие не дотягивают до планки "самый отбитый"..
В основном куда как ниже.
Следов много оставляют.

С таким же успехом можно спросить - а почему этот крокодил не забирает телефоны?! Он вроде как разумный, по крайней мере прятаться и подчищать за собой следы умеет.

А смысл-то какой?

С какой бы целью ни действовала спецгруппа, она захочет оставлять минимум следов. Маньяк - тоже, эти вообще расчленять любят. Людям не с руки оставлять улики.
Если почитать только этот форум, то легко узнать, что не все маньяки одинаково полезны любят расчленять.
Смысл я написал.
Огромное количество убитых жертв маньяков были как раз найдены. Потому что плохо и некачественно скрыты.
Или вообще не скрыты.

Про остальное я писал - тот кто похитил, может по разным причинам захотеть, чтобы тело нашли.

Просто как пример.. Давно читал, как жена с любовником мужа типа похитила, пытала, выпытала про вклады и скрытые счета, а потом прикончили и выбросили, чтоб его нашли.
Зачем?! А чтобы без вести пропавшим не объявили и можно было сразу в наследство вступать.
Не помню, на чем они погорели , но идея понятна.
Причин много..
« Последнее редактирование: 03.07.20 08:21 »

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #120 : 14.07.20 08:32 »
Нашел свидетельство очевидца. Как по мне, один в один наш случай.

Сначала небольшое введение: я не употребляю наркотики, алкоголь начал употреблять значительно позже этого случая (да и не в тех объёмах, чтоб «белку» словить можно было), с психикой тоже всё в порядке (хотя есть повышенная эмоциональная лабильность, но она появилась совсем недавно), в мистику и прочую хренотень из крипипаст не верю и считаю, что всему всегда есть простое объяснение (где-то фейк и монтаж, где-то животные с ветром шалят). Наверняка оно есть и у моего случая, но я так и не понял до конца.

Итак, в вузе я обучался на историка, после первого курса отправили нас всех на археологическую практику – кого-то в Тамань, а кого-то в Карелию. Жару всегда не любил, поэтому попросился во второе место. То, что мы там делали, для меня уже давно потеряло интерес, но если интересно - скину ссылку вторым постом.

С утра до вечера копались в земле и песке, чтобы отыскать частички прошлого. Остальное время студенты беспробудно бухали и спали. До сих пор забавит, что взятый на две недели запас алкоголя приговорили в первую же ночь, поэтому потом приходилось бегать в ближайший посёлок в 7-8 километрах от лагеря за спиртом. Спать ложились обычно в районе полуночи, чтобы и протрезветь до утра, и выспаться по-царски после физического труда. Посмотрите на прикреплённую картинку. 1 – кухня и стол, за которым мы трапезничали три раза в день. 2 – сами палатки в ста метрах от кухни. Время летнее, ночи в Карелии светлые, почти полярный день, поэтому я спокойно перед сном делал небольшую пробежку – пунктирная линия: выбегал из лагеря бежал неполный кружок, через деревья пробирался к воде, любовался видом, потом до лагеря обратно – так несколько раз за пробежку (туда-обратно – примерно 700-900 метров).

Раз в сутки назначался дежурный по быту, который должен был помогать поварихе подносить воду, разжигать костры, вскрывать консервы, закапывать органический мусор и упаковывать мусор неорганический, наливать воду в умывальники, топить баню – и всё это в перерывах между основной деятельностью по натиранию мозолей лопатами и щётками. Причём повинность с дежурством нельзя было передать другому челу, так как глава экспедиции чётко следил за всем и, если б такой мухлёж кто-то провернул, то за практику стоял бы незачёт, а это совсем уж лишний гемор.

Моя очередь дежурить пришла в начале второй недели моего пребывания там. К комарам и гнусу привык, диких животных мы там не видели и не слышали, ели лапки лягушек как французы (специально для веганов – мы их не убивали, не переживайте; просто отрубали лапки и отпускали дальше гулять), ели яйца муравьёв, наслаждались столбом дыма до неба где-то в сотне километров от нас (там хвойный лес горел), купались в озере, загорали. В общем, всё по кайфу жи есть, мне было абсолютно комфортно, поэтому ожидание дежурства несколько тяготило – мне не хотелось спать. Сначала я заранее наполнил все умывальники водой, принёс вёдра с водицей на кухню, нарубил дровишек – сделал всё заранее, чтобы утром подольше продрыхать. И вроде устал, но всё равно спать не было желания. Сел читать Эрнста Юнгера прямо за столом на кухне. Берег озера, полная тишь, даже насекомые не слишком беспокоят, заходящее солнце изредка отражается от водной глади, все люди из лагеря спят и не шумят. Покой и умиротворение… Где-то через час почувствовал, что сон всё-таки берёт своё. Значит, пора пробежаться по привычному маршруту. Книгу отнёс в палатку, переодел обувь, закрепил нож в шортах, чтобы не выпал, и пошёл к старту. Ну чё, готовы?

Первая странность меня смутила почти сразу – наличие большого числа паутины на привычном маршруте, словно там никто не ходил давно. Но, во-первых, я там каждые вечер/ночь бегал, во-вторых, это путь к лагерю, по которому трафик до посёлка проходит. Ну ок, сильно размышлять не стал, бегу до точки, на которой я сворачиваю к воде через деревья. Полюбовался видом, разворачиваюсь спиной к озеру, чтобы бежать обратно, и тут началося… Стойкое ощущение, что кто-то смотрит мне в затылок, только вот за мной озеро – из воды штоле кто-то буравит меня взглядом?! Бредятина полная, отогнал от себя эту мысль, но ощущение не уходило. Пробираюсь обратно к дорожке и постепенно меня накрывают две вещи – тотальная усталость, что аж хоть тут ложись и отдыхай, и всепоглощающий страх, который чувствуешь кожей – мурашки, волоски, скованные движения, желание закричать. Я совершенно не понимаю, что со мной происходит, иду автоматически и слабею, прямо нагибаясь к земле. От этого чуть-чуть теряю контроль, меня пошатывает, я натыкаюсь на деревья, ветки бьют по лицу и плечам, а в голове сам себе говорю «Ну полная херня, отравился я что ли, щас бы хоть на дорожку выйти, там уж доползу как-нибудь».

Не знаю, сколько прошло времени, но субъективно я на эти 50-100 метров чуть ли не полчаса потратил. Мысленно уже со всеми попрощался, представил, что помру прям тут, и тело никто никогда не найдёт, но всё равно двигался. И вот, наконец-то дорожка, по которой я сюда прибежал. Мне сразу стало легче, приободрился, страх прошёл, даже тревоги нет. Решаю добежать до лагеря и больше не делать кругов, лучше уж отдохнуть. Стартую живенько, бегу с нормальной скоростью, потоки воздуха привычно обволакивают тело, дорожка уходит вправо, всё как и надо, бегу в полной тишине – ни птиц, ни животных, ни шума озера, только мои шаги… И не мои. Я просто о**ел! Кто-то бежал за мной метрах в двух-трёх! Из моих кирпичей в ту секунду можно было бы Кремль отстроить, это смесь страха и паники, потому что я не понимаю, КАК КТО-ТО МОГ ПОДОБРАТЬСЯ ТАК КО МНЕ, И ЗАЧЕМ ОН ЭТО СДЕЛАЛ. С криком-рыком ААААААА оборачиваюсь с выхваченным ножом и никого вокруг не вижу, естественно. Чужие шаги исчезли, паника и страх тоже. Тру себе лицо, чтобы ДА Х** ЗНАЕТ ЗАЧЕМ, вроде прихожу в себя. Гоняю всякие мысли, типа «Надо просто очень сильно ускориться, лагерь-то метрах в 150-ти» и «Надо идти медленно, прислушиваться и оборачиваться, нож не выпускать – вдруг это животное какое». Решаю всё-таки бегом добираться, потому что очень уж страшно, хочется прекратить это скорее. Зачем-то ещё раз злобно кричу АААААА (отмечаю, что нет эха, хотя обычно есть – еще одна странность), разворачиваюсь и ускоряюсь как могу.

Всё как и ранее – бегу, дорожка уходит вправо, вот-вот лагерь появится. Вот-вот. Щас уже. Ещё чуть-чуть. Но них*я он не появляется, я будто по кругу бегу! «Надо засечь время, успокойся», «А может ты его пробежал?», «Нет, пробежать не мог, это исключено – упёрся бы в озеро». Я продолжаю бежать в полном непонимании, что происходит. Хочется и орать, и рыдать, и убивать виновников этой хрени, и смеяться без причины. Но я продолжаю бежать… Сейчас сложно сказать, но километра три, наверное, суммарно преодолел, хотя дорожка вся метров четыреста. Просто право, постоянно вправо, в полной тишине, только звук моих шагов и мысли в голове по кругу. «Что делать, что делать, что делать…», и тут снова появляется всепоглощающий ужас, да такой силы, что хочется ножом по шее себе полоснуть, лишь бы прекратить это. Я останавливаюсь, закрываю глаза и затыкаю уши. Череда вопросов «Что делать?!» резко сменяется мыслью «Надо поглубже в лес уйти, там-то отпустит уже». Даже чуть легче стало, хоть какое-то решение. Разворачиваюсь налево к лесу, делаю несколько шагов и понимаю, что это не моя мысль. Сложно описать, но я не думал эту мысль! Это точно не моя. Будто кто-то моим голосом со мной в моей же голове общается. Думаю «Ну всё, шизуха подоспела, а вроде нормальный был» и даже улыбаюсь. Следом новая мысль «Ладно, надо просто успокоиться. Вдохни и выдохни несколько раз. Ты тут один, бояться нечего. Надо просто приступ паники пережить. Ступай в лесок, там о дерево обопрись, отдохни». Вдох-выдох, и снова понимаю, что это не моя мысль – кто-то мне настойчиво вкладывает её в голову. Задаю вопросы «Что ты? Что тебе нужно?», ответа, естественно, не получаю. Снова нервно смеюсь от того, что сошёл с ума.

Так и стою с закрытыми глазами и ушами, вроде бы легче, но страх не ушёл. Внезапно появилось ощущение слежки, только если в начале мне казалось, что следят за спиной, то сейчас – со всех сторон! С криком ААААААААА сорвался и побежал дальше к лагерю, сзади снова шаги слышу тяжёлые. В голове только злобное «Идите нах*й, идите нах*й!», разворачиваюсь, кидаю куда-то нож – улетает к деревьям, снова убегаю, то ли спотыкаюсь, то ли ноги заплетаются – падаю на дорогу, начинаю громко мычать от боли, от досады, от страха. В голове снова не моя мысль «Успокойся, просто отойди в лес, в тишину», от этого уровень страха уносится в космос. Я вижу у дороги какой-то огромный камень рядом с двумя деревьями – как бы такой укромный уголок. Подрываюсь зачем-то туда, падаю без сил и весь зажимаюсь клубком.

Так лежал какое-то время в полной тишине, ощущая взгляды. Потом их словно меньше стало, потом вовсе прекратились. Мыслей в голове не было – ни моих, ни чужих. Я очень устал, мне хотелось просто уснуть. Кое-как я решил подняться и добираться до лагеря. На бег сил не было, да и болело всё – так и ковылял. Не прошло и десяти минут – я почти на месте! Как так вышло, что я бежал и не мог добежать? Начал размышлять над этим, и тут Х*ЯК! Мне стало так жутко, что ноги подкосились, снова упал. И в тишине повсюду тут и там звуки появились глухие. Просто постучите костяшками пальцев о монолитный камень – что-то похожее со всех сторон. И всё ближе, ближе, ближе ко мне. Я снова закрыл глаза, свернулся прямо на дорожке, но звуки одномоментно исчезли вместе с ужасом.

Снова встал и пошёл к лагерю. Дорожка продолжается дальше, к лагерю отворотка, на которой сразу развилка – к кухне или к палаткам. В самом начале развилки обращаю внимание, что за столом сидят однокурсники, решаю идти к ним. И снова страх появляется, нарастает и нарастает. Пока иду по тропе через деревья начинаю понимать, что что-то тут не то. Зачем они посреди ночи сидят? Ок, захотелось им поесть, но не всем же сразу! Да и когда увидел их вдалеке, не было заметно, чтобы кто-то их них ел. Да и вообще двигался… Тут снова дикий ужас, я тру лицо, вроде даже начинаю рыдать, спешу к ним, вырываюсь на поляну с кухней… Пусто. Никого нет. В голове снова не мой вопрос «Рад?». Сразу после страх мгновенно пропадает. Слышу писк комара. Я жив.

Прямо в одежде я повалился спать, утром ничего никому не сказал, чтобы не сочли ё*нутым. После этого я один там не передвигался, через неделю благополучно уехал. На родине в первый же день пошёл в парикмахерскую, где тётка-цирюльник удивилась числу седых волос. А мне и 20-ти лет не было, какие нахер седые волосы! Присмотрелся – действительно, много появилось. Как-то грустненько даже стало.

Итак, что это было? Я отметаю сразу всякую мистику, отметаю животных. Остаётся несколько версий. Первая – как в фильме «Явление» - растения (или дно озера) выпустили какие-то токсины, которые я словил и поймал бэд трип. Этакая природная психоделия. Вторая – я реально поехал кукухой. Но ни до, ни после с психикой проблем не было, да и комиссии всякие кучу раз проходил. Третья – депривация сна навлекла на меня глюки. Но, во-первых, не такое уж критическое было отсутствие сна, во-вторых, там могут быть отдельные элементы (однажды после ночи без сна боковым зрением увидел крыс, которые не обращали на меня внимание, потом понял, что они бы разбежались, и тут же крысы превратились в голубей, но и они меня не пугались – я ж рядом был; в итоге устремил взгляд на них, а это оказалась просто куча мусора, листьев и пыли), но никак не общая картина, которая никуда не уходила. В общем, не знаю, что это было. На всякий случай избегаю большой концентрации деревьев – а вдруг реально токсин какой был?

И вот вроде бы всё, но внимательный читатель спросит «А что помечено числом 3 на карте?». Тут уже никакой крипоты, чисто развлекуха, чтобы мне самому расслабиться после кирпичей. Я просто пометил шикарное место на небольшой высоте, куда я по ночам ходил срать, чтобы в лагере не шуметь. Только представьте: вы поднимаетесь на небольшой пригорок, наверху только низкорослые деревья и кусты, лёгкий тёплый ветерок обдувает со всех сторон, а перед вами открывается водная гладь, куда так и хочется разбежаться и нырнуть. Срать, ребята, нужно только в таких прекрасных местах, чтобы получать эстетическое удовольствие. Теперь точно всё.
« Последнее редактирование: 14.07.20 08:39 »

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #121 : 16.07.20 06:48 »
Интересно, в какие годы это произошло?!
Стиль изложения абсолютно современный - писал парень лет 30-ти или моложе.

Ну, к портала это явно никакого отношения не имеет, а может быть и авторские версии и НЛО, и СЧ и леший...

mrv


  • Сообщений: 8 379
  • Благодарностей: 8 572

  • Расположение: США

  • Была сегодня в 11:44

Missing 411
« Ответ #122 : 16.07.20 06:54 »
Я бы подумала, какой-то газ болотный, багульник цветущий, или что-то вроде такого...

Мартин Добров


  • Сообщений: 229
  • Благодарностей: 18

  • Был сегодня в 06:55

Missing 411
« Ответ #123 : 16.07.20 07:03 »
Интересно, в какие годы это произошло?!
Стиль изложения абсолютно современный - писал парень лет 30-ти или моложе.
Я свяжусь с автором и выясню подробности.

Цитирование
Ну, к портала это явно никакого отношения не имеет, а может быть и авторские версии и НЛО, и СЧ и леший...
Автор бегал одним и тем же маршрутом в одно и то же время, и вот:

Первая странность меня смутила почти сразу – наличие большого числа паутины на привычном маршруте, словно там никто не ходил давно.

Автор преодолел вход в квантовый карман и сейчас бежит по "параллельной" дорожке. Если его хватились в лагере, кричать бессмысленно.

бегу в полной тишине – ни птиц, ни животных, ни шума озера, только мои шаги…

Квантовый карман - это ограниченная область пространства, тесно примыкающая к родительскому и часто служащая его копией. Конечно, откуда там взяться птицам и животным? Озера тоже нет, как и его шума - только клочок земли.

Зачем-то ещё раз злобно кричу АААААА (отмечаю, что нет эха, хотя обычно есть – еще одна странность)

Трудно сказать, почему нет эха. Либо что-то впитывает звук (например, границы этой области), либо законы физики немного подкручены в ту сторону, которая нужна ее создателю.

Всё как и ранее – бегу, дорожка уходит вправо, вот-вот лагерь появится. Вот-вот. Щас уже. Ещё чуть-чуть. Но них*я он не появляется, я будто по кругу бегу! ... Но я продолжаю бежать… Сейчас сложно сказать, но километра три, наверное, суммарно преодолел, хотя дорожка вся метров четыреста.

Пространство можно и подрастянуть :) либо автор уже подвергается суггестии.

Ступай в лесок, там о дерево обопрись, отдохни». Вдох-выдох, и снова понимаю, что это не моя мысль – кто-то мне настойчиво вкладывает её в голову. Задаю вопросы «Что ты? Что тебе нужно?», ответа, естественно, не получаю.

Снова она, родимая. Хорошо, что автор устойчив к гипнозу.

В самом начале развилки обращаю внимание, что за столом сидят однокурсники, решаю идти к ним. И снова страх появляется, нарастает и нарастает. Пока иду по тропе через деревья начинаю понимать, что что-то тут не то. Зачем они посреди ночи сидят? Ок, захотелось им поесть, но не всем же сразу! Да и когда увидел их вдалеке, не было заметно, чтобы кто-то их них ел. Да и вообще двигался…

И еще разок. Дело происходит ночью, отсюда и удивление. Но автор уже вышел в наше с вами пространство. Возможно, это произошло еще раньше, когда он прилег у камня. Трудно сказать, почему его там не съели :) надо пообщаться и выяснить подробности.

Добавлено позже:
Я бы подумала, какой-то газ болотный, багульник цветущий, или что-то вроде такого...
Это будет притянутое за уши объяснение. Мне приходилось сталкиваться с головной болью на болоте :) от багульника не проглючит.

Можно было бы предположить шизофренический эпизод, но нету ни продромального периода, ни предпосылок. Человек отдыхает на природе, расслаблен, занят легким физическим трудом.
« Последнее редактирование: 16.07.20 07:08 »

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #124 : 16.07.20 07:34 »
В самом начале развилки обращаю внимание, что за столом сидят однокурсники, решаю идти к ним. И снова страх появляется, нарастает и нарастает. Пока иду по тропе через деревья начинаю понимать, что что-то тут не то. Зачем они посреди ночи сидят? Ок, захотелось им поесть, но не всем же сразу! Да и когда увидел их вдалеке, не было заметно, чтобы кто-то их них ел. Да и вообще двигался…
Вот!!!
Это самое яркое доказательство того, что вся ситуация происходила у него в голове.
В квантовом кармане его друзей не было, в реальной жизни им нечего так сидеть.
Игры его разума.

Трудно сказать, почему его там не съели  надо пообщаться и выяснить подробности.
Не съели его, потому что есть было некому))
Еще одно доказательство глюков. Или чего то с сознанием.

Я свяжусь с автором и выясню подробности
Спасибо. Было бы интересно..

mrv


  • Сообщений: 8 379
  • Благодарностей: 8 572

  • Расположение: США

  • Была сегодня в 11:44

Missing 411
« Ответ #125 : 16.07.20 10:07 »
Это не шизофрения, от шизофрении просто голоса в голове и странные мысли бывают, да и не проходит она вот так резко. Это явно какие-то глюки и что-то в лесу их вызвало, поэтому я и подумала на болотный газ. Может, там ночью что-то такое ядовитое цветет - нюхнул случайно и всё, а может с болота какого-нибудь облако газа ветром нанесло. Ещё ощущение сильного страха бывает от ультразвука, ощущение тяжести в теле может быть от отравления угарным газом, т.е. что-то там такое было в воздухе, только вот непонятно откуда...

И там он ещё пишет, что дежурные должные были баню топить. А он её топил? Может, надышался угарным газом, вот и начало глючить?
« Последнее редактирование: 16.07.20 10:40 »

VitDV

  • Под наблюдением

  • Сообщений: 874
  • Благодарностей: 420

  • Заходил на днях

Missing 411
« Ответ #126 : 17.07.20 03:59 »
Я свяжусь с автором и выясню подробности.
Автор бегал одним и тем же маршрутом в одно и то же время, и вот:

Первая странность меня смутила почти сразу – наличие большого числа паутины на привычном маршруте, словно там никто не ходил давно.

Автор преодолел вход в квантовый карман и сейчас бежит по "параллельной" дорожке. Если его хватились в лагере, кричать бессмысленно.

бегу в полной тишине – ни птиц, ни животных, ни шума озера, только
Можно было бы предположить шизофренический эпизод, но нету ни продромального периода, ни предпосылок. Человек отдыхает на природе, расслаблен, занят легким физическим трудом.
да ладно больше похоже на притягивание с этими квантовыми кармАнами, они раскапывали не мог чего нибудь интересного хватануть ввиде пыли или в лесу грибов на тонкой ножке схрумкать , резкий сдвиг ТС и пошло поехало словил бед трип.ножик он нашел свой

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #127 : 23.07.20 15:41 »
Очень, кстати, показательный рассказ .
Ясно даёт понять, что в рассказах такого рода излишние подробности только во вред.

Надо просто - я шел, почему-то испугался, еле убежал - это был точно ОН! (ОН - тут можно подставлять любое тематическое существо, существование которого , якобы, доказывает данный рассказ).

А здесь столько деталей.. Мама дарагая! И куда ни копни так и вылазят последствия глюков. Ну никак не натянуть эту сову на глобус существа какого мистического зловредного..

Нет, нет... Доказательства существ необычайных должны быть предельно компактными )))

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 832
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 13:27

Missing 411
« Ответ #128 : 01.08.20 11:39 »
Что за история?
Тела четырех человек, в том числе ребенка, обнаружили в номере одной из турбаз, расположенных в Алтайском крае. Об этом в пятницу, 31 июля, сообщает ТАСС со ссылкой на свой источник в экстренных службах региона.

«Был вскрыт один из номеров, люди долго не выходили. Там обнаружили четыре тела, в том числе несовершеннолетнего ребенка», — сказал собеседник агентства. Устанавливаются обстоятельства гибели людей. Проводится соответствующая экспертиза.

https://iz.ru/1042482/2020-07-31/troikh-vzroslykh-i-rebenka-nashli-mertvymi-v-nomere-turbazy-v-altaiskom-krae
кто в курсе более подробной информации? Отравление - пока не понятная версия.
Камень, который отвергли строители, сделался главою угла.

Бахoff под мескалином


  • Сообщений: 2
  • Благодарностей: 1

  • Был сегодня в 15:20

Missing 411
« Ответ #129 : 01.08.20 13:01 »
Что за история?
Семья из Барнаула из четырех человек, в том числе двое детей – мальчик 16 лет и девочка 12 лет – 26 июля приехала отдыхать на турбазу возле озера Ая. Как сообщили РИА «Новости», речь идет о туристической базе «Глобус», позиционирующей себя как «лучшее место для семейного отдыха».

Трупы всех четверых обнаружили сегодня, 31 июля, когда подошло время выселения. Дверь пришлось отпирать администраторам базы – она была закрыта изнутри, и на стук никто не реагировал. Явных следов криминала не обнаружено, возможно, люди погибли от отравления. Отмечается, что другие отдыхающие несколько дней замечали неприятный запах от комнаты.

По факту обнаружения тел четырех человек возбуждено уголовное дела по признакам преступления, предусмотренного ч. 2 ст. 105 УК РФ (убийство двух и более лиц), сообщает следственное управление Следственного комитета России по Алтайскому краю. Следователи устанавливают причину смерти погибших.

По данным СМИ, погиб 51-летний начальник отдела по взаимодействию с муниципальными СМИ управления по печати Алтайского края Иосиф Кременский, его супруга и дети.
Источник "Горно-Алтайск Инфо"

Запись с камер наблюдения показала, что после заселения никто из членов семьи из номера не выходил.
Источник "Вести Алтай"

Другие источники приводят довольно странное расположение тел: "Мужчина и 12-летняя девочка были совершенно голые на своих кроватях, мать была укрыта одеялом, а 16-летний подросток валялся в плавках на полу."
Источник: Life


Поблагодарили за сообщение: Sergei_VL

Дроздов


  • Сообщений: 244
  • Благодарностей: 243

  • Расположение: Москва

  • Был вчера в 10:38

Missing 411
« Ответ #130 : 03.08.20 17:59 »
По факту обнаружения тел четырех человек возбуждено уголовное дела по признакам преступления, предусмотренного ч. 2 ст. 105 УК РФ (убийство двух и более лиц), сообщает следственное управление Следственного комитета России по Алтайскому краю. Следователи устанавливают причину смерти погибших.
"По ходатайству следователя владельцу турбазы "Глобус" судом избрана мера пресечения в виде заключения под стражу", – сообщили в пресс-службе СУ СК по региону.

Мужчину подозревают в совершении преступления, предусмотренного частью 3 статьи 238 Уголовного кодекса РФ ("Оказание услуг, не отвечающих требованиям безопасности, повлекших по неосторожности смерть двух и более лиц").

В ходе следствия было установлено, что причиной смерти членов семьи стало отравление окисью углерода от дизель-генераторов.


Источник так себе, но на правду издалека похоже..
Подробнее: https://www.m24.ru/news/sudy/03082020/127597?utm_source=CopyBuf