Здравствуйте, Гость! Чтобы получить доступ ко всем функциям форума - войдите или зарегистрируйтесь.

Автор Тема: Missing 411  (Прочитано 7315 раз)

0 пользователей и 1 Гость просматривают эту тему.

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 833
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 08:12

Missing 411
« : 13.01.20 16:16 »
Предлагаю информацию по проекту David Paulides - Missing 411 обсуждать в этой теме.
На форуме накопилось много упоминаний проекта, предлагаю попробовать информацию об этом человеке, его деятельности, итогах и выводах аккамулировать здесь.

Добавлено позже:
Предлагаю разообрать это видео по пунктам

https://www.youtube.com/watch?v=B7cqx6CK0I0&feature=youtu.be#
« Последнее редактирование: 13.01.20 16:51 »
Камень, который отвергли строители, сделался главою угла.


Поблагодарили за сообщение: Солдат Василий

За отзывчивость и общественный авторитет 

Gulia70


  • Сообщений: 13 863
  • Благодарностей: 18 819

  • Расположение: Москва

  • Была 18.07.20 23:44

Missing 411
« Ответ #1 : 13.01.20 17:47 »
предлагаю здесь не зацикливаться только на СЧ. :)

Предлагаю разообрать это видео по пунктам
там 5 видео по этой теме.

сказано, что
-исчезновения людей происходят в любой точке мира.
-главным образом -на природе (лес, поле, горы)
-чаще всего люди пропадают незаметно. бывает так - шли группой, вроде все рядом, повернулись... одного уже нет.
-могут пропадать люди любого возраста и статуса. даже есть случаи, что пропадали охотники , которые знают этот лес и способы выживания .(есть такое видео, третье из цикла вроде)
-через какое-то время могут найти одежду (иногда сложенную стопочкой)
-при этом часто меняется погода на следующий день, что затрудняет поиски
-если человека находят, он может рассказывать странные вещи (типа глюков)
-иногда на поисках присутствует ФБР, которая обычно не выезжает на поиски (может проверяют версию с НЛО, СЧ и т.п.?)


Поблагодарили за сообщение: Sergei_VL | Солдат Василий

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 833
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 08:12

Missing 411
« Ответ #2 : 13.01.20 18:06 »
1-место
люди пропадают в ненаселенной местности, при том там есть водоемы
2-состояние
разные люди в разном состоянии (здоровые и больные, дети, молодые и старые)
3-собаки
быстро теряют или не находят след, не могут отследить запах
4-разделение
человек отошел от группы и пропал, часто безшумно или показалось что вскрикнул
5-погода
резкое, иногда аномальное изменение после случая с пропажей
6-одежда, обувь
обувь выкинута отдельно, одежда вывернута наизнанку или сложена и находится в труднодоступных местах, куда пропавший не мог бы ее отнести
7-заболевание
состояние схожее с гриппом, амнезия
8-ягоды
пропавший собирал грибы или ягоды
9-сопровождающиеся сущности
рассказы выживших о странных сущностях (ребенка кормил медведь или человек видел якобы знакомого)

Добавлено позже:
предлагаю здесь не зацикливаться только на СЧ. :)
Отвергая - предлагай,  *YES*
Я как изучающий тему СЧ, могу если понадобится, предположить объяснение по каждому пункту. Естесственно, в виде гипотезы.
« Последнее редактирование: 13.01.20 18:09 »
Камень, который отвергли строители, сделался главою угла.


Поблагодарили за сообщение: Солдат Василий

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 833
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 08:12

Missing 411
« Ответ #3 : 13.01.20 19:23 »
Возьмём пункт 3 - собаки не берут след пропавшего
Вопрос: сможет ли собака следовать за незнакомым тошноиворным неприятным ей запахом, перебивающим и не имеющим отношения к запаху того, кого ей надо искать?
Разворачиваемый текст
Ответ: нет конечно, она натаскана, допустим, на запах пропавшего в этом сюжете мальчика, а она чувствует на каком-то этапе сильно неприятный ей, даже пугающий, совсем другой запах.
Далее, в каком то месте запах пропавшего есть, а дальше его нет. О чем это говорит?
О том, что данный человек в одном месте наступал ногой, а дальше - нет, плюс его перебил другой, плохой запах. Почему ребенок там не наступал? Очень просто - похититель взял его на руки и унес. Вспомним странный вопрос пропавшего мальчика о медведе. Может он видел нечто, напомнившее ему медведя? И образ медведя не один раз встречаетмя в рассказах найденых малышей. "кормил медведь", "на болото занес медведь и приносил пищу".
Но вернемся к запаху. А если добавить то, что ребенок сам не шел, и есть еще один фактор, очень часто сопровождающий исчезновения - наличие реки или водоема, чего ждать от собаки в таком случае?
« Последнее редактирование: 13.01.20 19:24 »
Камень, который отвергли строители, сделался главою угла.


Поблагодарили за сообщение: Солдат Василий

wertik


  • Сообщений: 100
  • Благодарностей: 27

  • Расположение: Москва

  • Был 27.07.20 22:09

Missing 411
« Ответ #4 : 26.01.20 02:33 »
Отвергая - предлагай,  *YES*
Я как изучающий тему СЧ, могу если понадобится, предположить объяснение по каждому пункту. Естесственно, в виде гипотезы.
Всегда мне интересно почитать на эту тему.
Цитирование
1-место
люди пропадают в ненаселенной местности, при том там есть водоемы
Вот это прям как закономерность, а потом их находят в том водоеме..

За активное участие в жизни форума 

superskeptik


  • Сообщений: 4 974
  • Благодарностей: 3 467

  • Заходил на днях

Missing 411
« Ответ #5 : 26.01.20 03:46 »
там 5 видео по этой теме.сказано, что-исчезновения людей происходят в любой точке мира.-главным образом -на природе (лес, поле, горы)-чаще всего люди пропадают незаметно. бывает так - шли группой, вроде все рядом, повернулись... одного уже нет.-могут пропадать люди любого возраста и статуса. даже есть случаи, что пропадали охотники , которые знают этот лес и способы выживания .(есть такое видео, третье из цикла вроде)-через какое-то время могут найти одежду (иногда сложенную стопочкой)-при этом часто меняется погода на следующий день, что затрудняет поиски-если человека находят, он может рассказывать странные вещи (типа глюков)-иногда на поисках присутствует ФБР, которая обычно не выезжает на поиски (может проверяют версию с НЛО, СЧ и т.п.?)
И?
По каждому пункту можно предложить тривиальное объяснение (и даже не одно). Ничего необычного из этого не следует.
Увы и ах.

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #6 : 30.01.20 14:53 »
Под одним из роликов есть комментарий, в котором автор рассказывает о случае, произошедшем в квартире: вышла на балкон, чтобы переждать рекламную паузу, любовалась видами, а когда вернулась - передача уже закончилась. Оказалась, провела на балконе намного больше времени, чем казалось. Если бы шла по лесу, прошла бы значительное расстояние, и не заметила бы этого. В результате, имела бы неверные представления о своём местонахождении... Т.е., заблудилась бы.

Отойти в чащу, "что-то увидев" - запросто! Я когда-то рассказывала о странных впечатлениях в парке... Одно из них - показалось, что сделали "игрушечного" идола, вроде тех, которые ставят на детских площадках, вдобавок - что он был ярко раскрашен, а за ним - забор из сетки и какие-то интересные конструкции. Подумала "вроде, не должно тут быть такого", и пошла посмотреть... Ничего там не было: "рябь в глазах" и всё те же иллюзии из-за мерцания света между тонкими частыми стволами поросли.

Добавлено позже:
-могут пропадать люди любого возраста и статуса. даже есть случаи, что пропадали охотники , которые знают этот лес и способы выживания .(есть такое видео, третье из цикла вроде)
Я там обратила внимание на высказывание свидетеля о том, что он слышал звук, похожий на звук сработавшей металлической ловушки... Может, кто-то что-то подобное там использовал? Самая близкая версия из "теорий заговора" - о том, что стариков ловят геронтологи для опытов при создании лекарства от старости :) Другие варианты там высказывались: дырки в земле, волчьи ямы...

В пользу похищения - то, что авторитетного старичка искали таким методом, что обязательно должны были найти: живым или мёртвым. Либо под землю провалился, либо, к моменту начала поисков, его уже куда-то умыкнули.
« Последнее редактирование: 30.01.20 15:25 »

За отзывчивость и общественный авторитет 

Gulia70


  • Сообщений: 13 863
  • Благодарностей: 18 819

  • Расположение: Москва

  • Была 18.07.20 23:44

Missing 411
« Ответ #7 : 30.01.20 16:07 »
И?
По каждому пункту можно предложить тривиальное объяснение
можно. а я сказала, что там по каждому пункту инопланетяне?
я своими словами пересказала выводы David Paulides из ролика

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #8 : 30.01.20 18:35 »
По теме интересны два док. фильма Missing 411:

1) Missing 411 (2017). Акцент на исчезновения детей в лесах.
2) Missing 411: The Hunted (2019). Акцент на исчезновения охотников и опытных туристов. На мой взгляд более интересный.
Смотреть можно в любом порядке.

Во втором фильме есть аудиозапись  звуков существ, перекрикивающихся с охотниками. Достаточно разнообразные звуки; перекрикивались в прямом смысле, охотники пытались имитировать крики. Что интересно, перед "концертом" слышались металлические звуки (наподобие камертона), что неожиданно перекликается с известным видео Серёги-охотника  :cl:


Поблагодарили за сообщение: Sergei_VL

arfaxad


  • Сообщений: 889
  • Благодарностей: 716

  • Расположение: Кубань

  • Был сегодня в 01:50

Missing 411
« Ответ #9 : 30.01.20 20:02 »
David Paulides
Table 1. List of Purported Sasquatch DNA Specimens
(в т.ч. North America Bigfoot Search (Dave Paulides) From Ulibarri)
http://sasquatchgenomeproject.org/linked/tables-156.pdf
в этом документе приведена и нуклеотидная последовательность "СЧ":
CGCGCTGGTGGTGGCCACCAT
TGCTGGTGAGCGGGAGCAACG
CGGGAGCAACGTGCTGGAGAC
GACCCTGCCGCGGGCGCGGCG
ATCGCCTACTACGACCACGTG
ATCGCCTACTACGACCACGTG
TCTTCTTCCTGGCTATGCTGG
GCTATGCTGGTGCTCATGGCC
TGCCATCATCGACCCCCTCAT
GAGCTCCGCAGGACGCTCAA
тогда вот по этой последовательности вторичная белковая структура "СЧ":
https://funkyimg.com/i/31Q6X.jpg

дополнительно :
Novel North American Hominins, Next Generation Sequencing of Three Whole Genomes
and Associated Studies
http://www.sasquatchgenomeproject.org/linked/novel-north-american-hominins-final-pdf-download.pdf

DNA as evidence for the existence of relict hominoids
(ДНК как свидетельство существования реликтовых гоминоидов)
https://www.isu.edu/media/libraries/rhi/research-papers/HART-DNA-Evidence.pdf
Dr. Haskell V. Hart holds a PhD in chemistry from Harvard University and has a physical,
inorganic, and analytical chemistry research background. He was Associate Professor of
Chemistry, University of North Carolina at Wilmington, after which he was Senior Staff
Research Chemist and Research Manager at Shell Chemicals.
https://bigfootclaims.blogspot.com
« Последнее редактирование: 30.01.20 20:56 »
иногда счастье — это когда ничего не происходит

За отзывчивость и общественный авторитет 

Gulia70


  • Сообщений: 13 863
  • Благодарностей: 18 819

  • Расположение: Москва

  • Была 18.07.20 23:44

Missing 411
« Ответ #10 : 30.01.20 22:47 »
Акцент на исчезновения охотников
мне понравился эпизод с пожилым охотником. где его товарищ слышал звук захопывающейся ловушки.

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #11 : 31.01.20 00:26 »
мне понравился эпизод с пожилым охотником. где его товарищ слышал звук захопывающейся ловушки.
Если это первый случай (с 82-летним охотником), то товарищ сказал что-то вроде "короткий звук, который он не может описать, не похожий ни на один лесной звук".

Во втором фильме есть аудиозапись  звуков существ, перекрикивающихся с охотниками.
А вот добрые люди с reddit уже её извлекли из фильма и немного почистили:
https://old.vocaroo.com/i/s14IioKZWSD1

arfaxad


  • Сообщений: 889
  • Благодарностей: 716

  • Расположение: Кубань

  • Был сегодня в 01:50

Missing 411
« Ответ #12 : 31.01.20 21:08 »
David Paulides
при исследовании биологических образцов были и сюрпризы, например два образца волос из Гималаев
совпали с ДНК, извлечённой у 40000-летнего ископаемого полярного медведя, и что странно, их ДНК
не совпадает с живущими сегодня полярными медведями.
учёным просто нужно найти больше ДНК этих загадочных животных, если другие участки ДНК также
совпадают с участками древних полярных медведей, тогда эту нулевую гипотезу можно будет отвергнуть.
так нулевая гипотеза поддерживает жизнь волосатого гоминида.
https://habr.com/ru/post/409063/
&
было бы прикольно если бы в биообразцах "СЧ" нашли бы 5-й и 6-й нуклеотид ДНК новую базовую пару.
в земных ДНК их всего 4 вида нуклеотидов.
https://www.yapfiles.ru/show/576379/87595601d4e698cf8d96fb6fdaa27d02.flv.html
&
пока мы имеем то что имеем, благодаря в том числе неутомимому детективу  Dave Paulides обнаружены
биологические образцы артефакты, в этих образцах найдена определённым образом структурированная
нуклеотидная последовательность, при всём при том что искалась по аналогии с земными ДНК:
http://sasquatchgenomeproject.org/linked/tables-156.pdf
по этой последовательности можно определить вторичную структуру белка принадлежащего "СЧ".
Sasquatch-n1.pdb :
http://forumfiles.ru/files/001a/87/44/46482.txt
вот визуализация 3D модель вторичной структуры этого найденного протеина.

в Jmol 14.30.1 2019 :
Jmol - Browse /Jmol/Version 14.30/Jmol 14.30.1 at SourceForge.net
https://sourceforge.net/projects/jmol/files/Jmol/Version%2014.30/Jmol%2014.30.1/
для любителей поизучать, для этого не надо быть молекулярным биологом.
иногда счастье — это когда ничего не происходит


Поблагодарили за сообщение: Sergei_VL

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 833
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 08:12

Missing 411
« Ответ #13 : 01.02.20 12:41 »
arfaxad, а откуда у всех такая вера в непогрешимость исследований ДНК? И еще больше смущает этот радиоуглеродный анализ, который всегда дает результат исследования любых костей десятки тысяч лет, и никогда не выдает 200 лет, 300 лет, 750 лет, тысячу лет?  Нашли на Новосибирских островах тушу мамонта, все волосы целы, разморозили - кровь льется. Заключение: "туша пролежала 40 000 лет". Ну и что лед? Кости животного за 10 лет так истлевают, а тут несоизмеримые величины!
Есть ощущение, что брехня с доисторическими видами, жившими якобы ТАК давно многим попросту выгодна. ...Всё не наше, необычное могло быть только в глубокой древности, а там кто знает - всё могло быть, никто теперь за это не ручается.
« Последнее редактирование: 01.02.20 12:42 »
Камень, который отвергли строители, сделался главою угла.


Поблагодарили за сообщение: arfaxad

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #14 : 01.02.20 14:53 »
Sergei_VL, позвольте вставить 5 копеек.

"Вера" в ДНК заключается в том, что этот метод широко используется в повседневной жизни (напр. в криминалистике и судебной практике это разница между свободой и электрическим стулом). И при наличии образцов, исследование воспроизводимо любым другим исследователем в любой другой точке мира (так, напр. в исследовании Сайкса контрольные образцы есть и в Швейцарии).

Если криптозоолог не желает пользоваться научными инструментами, он может "публиковаться" на форумах, им самим созданным журналах, сайтах и проч., и "здравомыслящей рациональной части человечества" его откровения не интересны, т.к. он попадает в разряд НЛО, заряженной воды, хиромантии, лечения уриной и проч.

Если исследователь пользуется научными инструментами, но пытается подогнать результаты под свои убеждения, то опять же его данные не пройдут peer review научного журнала, и остается публиковаться самому (грубо говоря, в стенгазете). См. пример Кетчам.

Если исследователь работает в русле научного метода, он и публикуется нормально, может ошибаться, признавать ошибки и искать истину дальше. См. пример Сайкса. Тут, понятно, если исследователь ученым не является, образования не имеет, то обратить на себя внимание ему сложнее и через фильтр скептицизма пройти. Но это возможно, если его публикации или данные валидны и должным образом оформлены.

Однако нельзя не отметить, что "научное сообщество" вовсе не рыцари, они ошибаются и испытывают эмоции, напр. страх. Так, какой-нибудь член редколлегии просто откажется рассматривать исследования о сасквочах, из-за страха прослыть мракобесом и повредить репутации журнала. Или проявит тупой догматизм (см. скандал по поводу глобального потепления).

Вкратце: есть выбор между имиджем добросовестного исследователя и фрика-паранормальщика. От имиджа зависит то, как будут восприняты результаты исследований. Кстати, прекрасное на мой взгляд качества Дэвида Полидеса это то, что он сейчас только нарабатывает данные в своих книгах и фильмах, пытается привлечь внимание общественности, а не выпускает на первый план сасквотчей без каких-либо обоснований.

По радиоуглеродному исследованию: см. контаминацию углеродом после промышленной революции, Туринская плащаница, мамонты на о. Врангеля.


Поблагодарили за сообщение: arfaxad

arfaxad


  • Сообщений: 889
  • Благодарностей: 716

  • Расположение: Кубань

  • Был сегодня в 01:50

Missing 411
« Ответ #15 : 01.02.20 20:18 »
откуда у всех такая вера в непогрешимость исследований ДНК
пока насколько можно судить по литературе идёт сравнение неизвестного с известным.
это тот метод который в данном случае можно применить с научной точки зрения,
если находят различные биоматериалы (шерсть, когти, продукты жизнедеятельности и пр.)
то исследователи их прогоняют через тесты ДНК на принадлежность к тем или иным
известным животным, при этом остаются результаты исследований которые качественно
нельзя с полной уверенностью отнести к определённым отрядам и группам, видам.

так как сравнение надо делать чтобы совпали эти короткие найденные цепочки AGCT с огромным
количеством уже имеющихся известных образцов в генбанках, с учётом того что эту работу
делают не на государственном уровне, а на уровне энтузиастов криптозоологов, которые
самостоятельно изучают форматы файлов FASTA и PDB (био), NCBI онлайновые протеиновые
сервисы, прикладные программы по молекулярной биологии, и др.
ещё один момент почему повсюду у учёных находятся чёрные вымершие медведи и нет "СЧ",
они же не могут пожертвовать ради своих исследований профессиональной карьерой и
репутацией академических учёных, ведь про медведей они могут писать всю жизнь и получать
зарплату, а про "СЧ" только один раз, после чего отправятся на биржу труда как фрики от науки.
и алгоритм определения инопланетных ДНК отсутствует именно по причине неизвестных пока
признаков таких ДНК, станут известны перестанут кивать на мутации, скажут вторжение.
это же справедливо не только в отношении вирусов известных пандемий, но и онковирусов.
иногда счастье — это когда ничего не происходит

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 833
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 08:12

Missing 411
« Ответ #16 : 02.02.20 16:15 »
https://newsfeed.time.com/2012/11/29/bigfoot-is-part-human-according-to-dubious-sounding-bigfoot-dna-tests/
Вот про ДНК: "близко к человеку"
Важно воспринимать как именно дикого человека, а не животное - это ключ.
Но лучше по СЧ в отдельно существующей теме.
Камень, который отвергли строители, сделался главою угла.

AtlanticPacific


  • Сообщений: 113
  • Благодарностей: 146

  • Расположение: Москва

  • Был 07.08.20 17:38

Missing 411
« Ответ #17 : 02.02.20 22:32 »
По теме интересны два док. фильма Missing 411:

1) Missing 411 (2017). Акцент на исчезновения детей в лесах.
2) Missing 411: The Hunted (2019). Акцент на исчезновения охотников и опытных туристов. На мой взгляд более интересный.
Смотреть можно в любом порядке.

Во втором фильме есть аудиозапись  звуков существ, перекрикивающихся с охотниками. Достаточно разнообразные звуки; перекрикивались в прямом смысле, охотники пытались имитировать крики. Что интересно, перед "концертом" слышались металлические звуки (наподобие камертона), что неожиданно перекликается с известным видео Серёги-охотника  :cl:
А что это за известное видео? Мне Гугл миллион вариантов просто предложил

По теме: меня у автора немного смущает тенденция к каталогизации, что ли: помните, он делил пропавших чуть ли не по принадлежности к языковой группе. Понятно, что за этим стоит желание найти ответ, но выглядит немного странно.
« Последнее редактирование: 02.02.20 22:37 »

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 833
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 08:12

Missing 411
« Ответ #18 : 02.02.20 22:49 »
По теме: меня у автора немного смущает тенденция к каталогизации, что ли: помните, он делил пропавших чуть ли не по принадлежности к языковой группе. Понятно, что за этим стоит желание найти ответ, но выглядит немного странно.
Он обязан установить закономерности тех, кто пропадал, чтобы выйти на причину. Это - единственный способ - фиксировать все случаи и сводить в таблицу. С таблицами как раз интересные дела получаются: начинают вырисовываться одни и те же детали пропаж.
Например. Пропадает человек всегда в одиночку. Подставим некий нелепый пример, чтобы получить "доказательство от противного". К примеру, открывается некий портал, который поглащает несчастного. Или: человек в определенной геомагнитной точке начинает терять ориентировку. Ок. Допустим так. Но поисковики не теряют там ориентировку, а хитрый портал забирает человека одного, когда никто не видит, а не двух, не группу, не десять. Ничего не смущает? А нет ли ощущение, что нечто имеет избирательный характер, оно как бы выслеживает одинокого путника? А как выслеживать может неодушевленное?
И сразу туман, который нагоняется в сетях, рассеивается, а куча нелепых версий отпадают.
Камень, который отвергли строители, сделался главою угла.


Поблагодарили за сообщение: auspex

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #19 : 02.02.20 23:59 »
AtlanticPacific,
Серега-охотник ч.2
https://www.youtube.com/watch?v=dWdpDGJbXZk#


По теме: меня у автора немного смущает тенденция к каталогизации, что ли: помните, он делил пропавших чуть ли не по принадлежности к языковой группе. Понятно, что за этим стоит желание найти ответ, но выглядит немного странно.
Как правильно написал выше Sergei_VL, "Это - единственный способ - фиксировать все случаи и сводить в таблицу". Но Дэвид замечен в применении confirmation bias (подгонку результатов под канву исследования). Напр. недооценивает смертельность гипотермии (как раз по тематике форума), иногда опускает такие детали, как наркотическое опьянение жертвы и проч. Надо же как-то книги продавать, тут всё понятно  :-[

Главное, что методика его верная, как мне кажется: собирать, каталогизировать, наносить на карту, сопоставлять. А как к гуру относиться и секту образовывать вокруг него, ну нафиг.

А как выслеживать может неодушевленное?
Да очень просто, по набору качеств. Ваш никнейм начинается на S, имеет 9 символов, тон аватарки тёмный, пишете по-русски -- неодушевленная софтина вас выберет на форуме среди десятка других представленных на некой странице.

В нете есть софтбольные автоматические турели на Ардуино с распознаванием движения и фигуры человека. Можно прикрутить тепловизор, добавить кода -- et voila, турель будет стрелять первым в самого теплого, ну или холодного. И так далее.
« Последнее редактирование: 03.02.20 00:00 »

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 833
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 08:12

Missing 411
« Ответ #20 : 03.02.20 03:39 »
Да очень просто, по набору качеств. Ваш никнейм начинается на S, имеет 9 символов, тон аватарки тёмный, пишете по-русски -- неодушевленная софтина вас выберет на форуме среди десятка других представленных на некой странице.
Так, выбрала. С какой целью? Некто сидит в форуме. А некто поехал на природу и пропал. Какая связь?
Цитирование
В нете есть софтбольные автоматические турели на Ардуино с распознаванием движения и фигуры человека. Можно прикрутить тепловизор, добавить кода -- et voila, турель будет стрелять первым в самого теплого, ну или холодного. И так далее.
Автовыбор программы. А кто тепловизор прикручивает, робот, который должен следить за случайным объектом?
Чего-то вы "не в ту степь".
Камень, который отвергли строители, сделался главою угла.

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #21 : 03.02.20 09:30 »
Какая связь?
Не воспринимайте буквально. Я имел в виду, что для избирательности "виновнику" не нужен интеллект.

Чего-то вы "не в ту степь".
У меня нет "степи" пока, но порталы и тайные подземные базы похитителей всерьез не рассматриваю.
Хотя любители порталов приободрились:
https://www.nasa.gov/mission_pages/sunearth/news/mag-portals.html

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 833
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 08:12

Missing 411
« Ответ #22 : 03.02.20 09:39 »
Не воспринимайте буквально. Я имел в виду, что для избирательности "виновнику" не нужен интеллект.
Для меня не понятно. Приборы по похищению людей кто то изобрел, и они настроены строго на одного?
Камень, который отвергли строители, сделался главою угла.

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #23 : 03.02.20 09:56 »
Для меня не понятно. Приборы по похищению людей кто то изобрел, и они настроены строго на одного?
Приборы были для примера. Можете взять существо с простым таксисом, если хотите что-то биологическое, но не способное к мышлению.

Я думаю, не существуют вообще никаких надежных рациональных способов узнать на расстоянии (и быстро), какая из потенциальных жертв имеет хорошее образование или германские корни. А если тепло одетая жертва повернута спиной или носит лыжную маску, то и возраст просто так не определишь.

Возраст, раса, герм. корни и образование это маркеры-критерии Дэвида, не мои.

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 833
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 08:12

Missing 411
« Ответ #24 : 03.02.20 10:36 »
Приборы были для примера. Можете взять существо с простым таксисом, если хотите что-то биологическое, но не способное к мышлению.

Я думаю, не существуют вообще никаких надежных рациональных способов узнать на расстоянии (и быстро), какая из потенциальных жертв имеет хорошее образование или германские корни. А если тепло одетая жертва повернута спиной или носит лыжную маску, то и возраст просто так не определишь.

Возраст, раса, герм. корни и образование это маркеры-критерии Дэвида, не мои.
Идут по каньону Колорадо 10 человек. Один из них мальчишка со своим рюкзачком. Группа растянулась, одни шли спереди, другие - позади. Он где то между теми и теми. Сбился немного, прошел по какой-то другой тропке. Через 7 минут его стали звать, через 20 искать. Пару месяцев сотни человек с техникой и собаками не могут ничего обнаружить, прочесывая ельники и скалы по десяткам раз - никаких следов, находят только его одежду и обувь.
Тот же самый риторический вопрос - ни один интеллект, искусственный или натуральный, не может просчитать вероятности что:
- группа будет состоять из стольких-то человек, это не задумка, а импровизация
- группа выйдет в определенное время и на точке пропажи ребенок тоже окажется в определенное время
- ребенок оторвется от группы
- место, куда надо уходить, забрав его, не будет посещаемым и ребенка не заметят
Все параметры случайны. 1987 год. Какие таксисты с системами слежения и софтина, осуществляющая отбор жертвы по аватару???)))
Камень, который отвергли строители, сделался главою угла.

auspex


  • Сообщений: 74
  • Благодарностей: 92

  • Расположение: Minsk

  • Был 22.05.20 00:08

Missing 411
« Ответ #25 : 03.02.20 11:01 »
Какие таксисты с системами слежения и софтина, осуществляющая отбор жертвы по аватару???)))
Понял, аналогии вам "больше не наливать". Значение слова "таксис" посмотрите в Вики сами, если пожелаете.

Далее, по представленному вами случаю, версии могут быть а) нормальные (а1 под оползнем, а2 криминал, а3 звери...) и б) паранормальные (б1 порталы б2 бигфут б3 заговор правительства...). Никаких версий я не выбирал, а просто указал вам, что в категории Б могут быть варианты без участия разума и плана. Например, гипотетический портал способен переносить людей массой до 40 кг, и только при скорости солнечного ветра > 800 км/с, и только в радиусе 20 метров. Поэтому ни другие участники похода, ни дети в другие дни, ни поисковики в него не попали. Понимаете?

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 833
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 08:12

Missing 411
« Ответ #26 : 03.02.20 13:20 »
Далее, по представленному вами случаю, версии могут быть а) нормальные (а1 под оползнем, а2 криминал, а3 звери...) и б) паранормальные (б1 порталы б2 бигфут б3 заговор правительства...).
Начнем с Дэвида. Сам он не мог не склоняться к какой-то одной, дежурной версии. Теперь информация о его размышлениях перемешана черти с чем и мы истину о его мнении никогда не узнаем. Но я предлагаю придержитваться формулы Дэвида: одна из причин - общая для всех случаев, она неизвестна, вторая - естесственные версии, перемешавшиеся с основными, автор не смог их однозначно отбросить как не пригодные к проекту 411.
a1 - вероятность оползней автор должен был рассматривать и все случаи имеющие "природный катаклизм, вряд ли бы попали в проект 411.
а2 - предполагает одушевленное существо или существ, смущает только огромное количество жертв, у серийника с типичным в конкретной ситуации поведения не может быть такого количества аналогичных случаев, но в частности - очень вероятно,
а3 - вероятно, но часто имеет место странное поведение жертвы,
б1 - один отбившийся человек не может постоянно быть жертвой порталов, портал - неодушевленное; с другой стороны - портал очень сложное для понимания и неопределенное, надо искать более простые решения
б2 - очень вероятно, и Дэвид одно время проводил параллели со следами и свидетелями bf в районе пропаж,
б3 - исключается: правительство - люди на доожности, им невозможно подбирать агентов, чтобы они воровали маленьких детей, здесь одни противоречия;
но заговор правительства может иметь место в варианте с bf. Возможно, этих существ не хотят озвучивать по некоторым причинам, например, те же неисследованные опасные вирусы.
Цитирование
Никаких версий я не выбирал, а просто указал вам, что в категории Б могут быть варианты без участия разума и плана. Например, гипотетический портал способен переносить людей массой до 40 кг, и только при скорости солнечного ветра > 800 км/с, и только в радиусе 20 метров. Поэтому ни другие участники похода, ни дети в другие дни, ни поисковики в него не попали. Понимаете?
Я не зря вам указывал на разумный след - живых существ. Избирательность на пути следования человека. Никто никогда на глазах у свидетелей не растворялся, но человек вдруг поднялся на гору сфоткать, где его было не видно, или зашел в лесок или потерялся.
Камень, который отвергли строители, сделался главою угла.

За активное участие в жизни форума 

superskeptik


  • Сообщений: 4 974
  • Благодарностей: 3 467

  • Заходил на днях

Missing 411
« Ответ #27 : 04.02.20 00:52 »
можно. а я сказала, что там по каждому пункту инопланетяне?
я своими словами пересказала выводы David Paulides из ролика
Так выводы (его, а не ваши (я к Вам без претензий)) пустые.
"Экстраординарные заявления требуют экстраординарных доказательств".
А тут заявление примерно следующего содержания: "все люди смертны". Так все это и так знают.

За активное участие в жизни форума 

Sergei_VL

  • Автор темы

  • Сообщений: 10 833
  • Благодарностей: 3 466

  • Расположение: Москва

  • Был сегодня в 08:12

Missing 411
« Ответ #28 : 04.02.20 07:35 »
А тут заявление примерно следующего содержания: "все люди смертны". Так все это и так знают.
В качестве ответа родственникам пропавших интересный вариант, из серии все там будем.
Дэвид не обобщал случаи, а классифицировал, это разные вещи. Он составлял таблицу с целью определить закономерности. А главное отсеить шапкозакидательные заявления не желавших вникать в непонятные дела.
Обобщать конечно можно, но это и есть - непрофессиональное отношение в расследовании.
« Последнее редактирование: 04.02.20 07:36 »
Камень, который отвергли строители, сделался главою угла.

ЁлыПалы


  • Сообщений: 1 427
  • Благодарностей: 556

  • Расположение: Москва

  • Была 01.08.20 09:42

Missing 411
« Ответ #29 : 04.02.20 19:24 »
Никто никогда на глазах у свидетелей не растворялся, но человек вдруг поднялся на гору сфоткать, где его было не видно, или зашел в лесок или потерялся.
Вот это и наводит на мысль о том, что причина - в странных действиях самих пропавших людей. Причина, по которой человек уходит в какой-то лесок, часто непонятна: объяснимой причины нет. Например, девушка хотела фотографировать озеро, а сама, пройдя по берегу, зачем-то зашла в лес. Другая шла по тропе, но вдруг будто что-то увидела, и свернула в лес. При этом, место было очень неудобным для сворачивания в ту сторону. За 300 метров по некрутой тропе до вершины, на которую шла группа, мальчик жалуется на сильную усталость и выражает желание подождать группу на этом месте, а потом встаёт и зачем-то куда-то уходит - не за группой, и даже не по какой-то тропе, а по каменистому склону. Вот так он "сильно устал"... И всё это - в местности с редкими деревьями, где всё хорошо просматривается.

Про раздевания: отмечает ли автор книги температуры, при которых произошло раздевание? Думаю, что случай с девушками в панамских джунглях - пример такого же раздевания, но в тёплых условиях. Объяснения в стиле "промокла, и повесила одежду сушиться" и "сняла обувь потому, что нога болела" не кажутся убедительными: эти вещи почему-то были оставлены, а не взяты с собой.
« Последнее редактирование: 04.02.20 19:32 »